Clec9a (NM_172732) Mouse Untagged Clone
CAT#: MC212943
Clec9a (untagged) - Mouse C-type lectin domain family 9, member a (Clec9a), transcript variant 2, (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 9830005G06Rik; DNGR-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212943 representing NM_172732
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_172732 |
Insert Size | 717 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_172732.2, NP_766320.2 |
RefSeq Size | 1156 bp |
RefSeq ORF | 717 bp |
Locus ID | 232414 |
UniProt ID | Q8BRU4 |
Gene Summary | Functions as an endocytic receptor on a small subset of myeloid cells specialized for the uptake and processing of material from dead cells. Recognizes filamentous form of actin in association with particular actin-binding domains of cytoskeletal proteins, including spectrin, exposed when cell membranes are damaged, and mediate the cross-presentation of dead-cell associated antigens in a Syk-dependent manner.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223094 | Clec9a (tGFP-tagged) - Mouse C-type lectin domain family 9 member a (Clec9a), (10ug) |
CNY 5200.00 |
|
MR223094 | Clec9a (Myc-DDK-tagged) - Mouse C-type lectin domain family 9, member a (Clec9a), transcript variant 2 |
CNY 3600.00 |
|
MR223094L3 | Lenti ORF clone of Clec9a (Myc-DDK-tagged) - Mouse C-type lectin domain family 9, member a (Clec9a), transcript variant 2 |
CNY 6000.00 |
|
MR223094L4 | Lenti ORF clone of Clec9a (mGFP-tagged) - Mouse C-type lectin domain family 9, member a (Clec9a), transcript variant 2 |
CNY 6000.00 |