Ffar1 (NM_194057) Mouse Untagged Clone
CAT#: MC212962
Ffar1 (untagged) - Mouse free fatty acid receptor 1 (Ffar1), (10ug)
CNY 2400.00
CNY 3990.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Gpr40 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NM_194057.2
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACCTGCCCCCACAGCTCTCCTTCGCTCTCTATGTATCTGCCTTTGCGCTGGGCTTTCCATTGAACT TGTTAGCCATCCGAGGCGCAGTGTCCCACGCTAAACTGCGACTCACTCCCAGCTTGGTCTACACTCTCCA TCTGGGCTGCTCTGATCTCCTACTGGCCATCACTCTGCCCCTGAAGGCTGTGGAGGCCCTGGCTTCTGGA GCCTGGCCCCTGCCGCTCCCCTTCTGCCCAGTCTTTGCCTTGGCCCACTTTGCTCCCCTCTACGCAGGCG GAGGCTTCCTAGCTGCTCTCAGCGCTGGCCGCTACCTGGGGGCTGCCTTCCCCTTCGGGTACCAAGCCAT CCGGAGGCCCCGCTATTCCTGGGGTGTGTGTGTGGCTATATGGGCCCTTGTCCTCTGCCACCTGGGGCTG GCCCTTGGCTTGGAGACTTCCGGAAGCTGGCTGGACAACAGTACCAGTTCCCTGGGCATCAACATACCCG TGAATGGCTCCCCGGTCTGCCTGGAAGCCTGGGATCCCGACTCTGCCCGCCCTGCCCGTCTCAGTTTCTC CATTCTGCTCTTCTTTCTGCCCTTGGTCATCACTGCCTTCTGCTATGTGGGCTGCCTCCGGGCCCTGGTG CGCTCAGGCCTGAGCCACAAACGGAAGCTCAGGGCAGCTTGGGTGGCCGGAGGCGCTCTCCTCACACTCC TGCTCTGCCTGGGGCCCTATAATGCCTCCAATGTGGCTAGTTTCATAAACCCGGACCTAGGAGGCTCCTG GAGGAAGTTGGGACTCATCACAGGGGCCTGGAGTGTGGTACTCAACCCACTGGTCACTGGCTACTTGGGA ACAGGTCCTGGACGGGGAACAATATGTGTGACGAGGACTCAAAGAGGAACAATTCAGAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_194057 |
| Insert Size | 903 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_194057.2, NP_918946.2 |
| RefSeq Size | 903 bp |
| RefSeq ORF | 903 bp |
| Locus ID | 233081 |
| UniProt ID | Q76JU9 |
| Gene Summary | G-protein coupled receptor for medium and long chain saturated and unsaturated fatty acids that plays an important role in glucose homeostasis. Fatty acid binding increases glucose-stimulated insulin secretion, and may also enhance the secretion of glucagon-like peptide 1 (GLP-1). May also play a role in bone homeostasis; receptor signaling activates pathways that inhibit osteoclast differentiation (PubMed:23335512). Ligand binding leads to a conformation change that triggers signaling via G-proteins that activate phospholipase C, leading to an increase of the intracellular calcium concentration. Seems to act through a G(q) and G(i)-mediated pathway.[UniProtKB/Swiss-Prot Function] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Branched fatty acid esters of hydroxy fatty acids (FAHFAs) protect against colitis by regulating the gut innate and adaptive immune systems
,Lee, J;Moraes-Vieira, PM;Castoldi, A;Aryal, P;Yee, EU;Vickers, C;Parnas, O;Donaldson, CJ;Saghatelian, A;Kahn, BB;,
J. Biol. Chem.
,PubMed ID 27573241
[Ffar1]
|
|
ß-arrestin recruitment and biased agonism at free fatty acid receptor 1
,Mancini, A;Bertrand, G;Vivot, K;Carpentier, É;Tremblay, C;Ghislain, J;Bouvier, M;Poitout, V;,
J. Biol. Chem.
,PubMed ID 26157145
[FFAR1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222997 | Ffar1 (tGFP-tagged) - Mouse free fatty acid receptor 1 (Ffar1), (10ug) |
CNY 4000.00 |
|
| MR222997 | Ffar1 (Myc-DDK-tagged) - Mouse free fatty acid receptor 1 (Ffar1) |
CNY 2400.00 |
|
| MR222997L3 | Lenti ORF clone of Ffar1 (Myc-DDK-tagged) - Mouse free fatty acid receptor 1 (Ffar1) |
CNY 4750.00 |
|
| MR222997L4 | Lenti ORF clone of Ffar1 (mGFP-tagged) - Mouse free fatty acid receptor 1 (Ffar1) |
CNY 4800.00 |

