Il17c (NM_145834) Mouse Untagged Clone
CAT#: MC212995
Il17c (untagged) - Mouse interleukin 17C (Il17c), (10ug)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL-17C |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212995 representing NM_145834
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTCTCCTGCTTCTAGGCTGGTTGCCTACTGGGATGACCCACCAAGATCCCCCGTCCTGGGGGAAAC CCCGAAGCCATAGGACCCTGCGGTGCTACTCTGCTGAGGAATTATCTCACGGCCAGGCTCCTCCACACCT GCTAACTCGAAGTGCCAGGTGGGAGCAGGCCCTCCCTGTGGCCCTGGTGGCCAGTTTGGAGGCCACGGGC CACAGGAGACAGCATGAAGGACCTCTAGCTGGAACACAGTGCCCCGTGCTGCGGCCGGAGGAGGTGCTGG AAGCTGACACTCACGAGCGCTCCATCTCACCATGGAGATATCGCATCGACACAGATGAGAACCGCTACCC ACAGAAGCTGGCGGTGGCAGAATGCTTGTGTCGTGGATGCATCAACGCCAAGACAGGCCGTGAGACAGCT GCCCTGAACTCGGTGCAGCTGCTGCAGAGCCTGCTGGTACTACGGCGACAGCCCTGCTCCCGAGACGGCA CGGCGGACCCTACACCAGGATCCTTCGCCTTCCACACCGAGTTCATCCGCGTGCCTGTCGGCTGCACCTG CGTTCTTCCCAGGTCTACACAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_145834 |
| Insert Size | 585 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145834.3, NP_665833.3 |
| RefSeq Size | 656 bp |
| RefSeq ORF | 549 bp |
| Locus ID | 234836 |
| UniProt ID | Q8K4C5 |
| Gene Summary | Cytokine that plays a crucial role in innate immunity of the epithelium, including to intestinal bacterial pathogens, in an autocrine manner. Stimulates the production of antibacterial peptides and proinflammatory molecules for host defense by signaling through the NFKB and MAPK pathways. Acts synergically with IL22, TNF and IL1B in inducing antibacterial peptides. May have protective function by maintaining epithelial homeostasis after an inflammatory challenge, such as that caused in the intestine by dextran sulfate sodium in a colitis model. May also promote an inflammatory phenotype, such as skin in a psoriasis model. Enhanced IL17C/IL17RE signaling may also lead to greater susceptibility to autoimmune diseases, such as autoimmune encephalitis.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222634 | Il17c (tGFP-tagged) - Mouse interleukin 17C (Il17c), (10ug) |
CNY 2850.00 |
|
| MR222634 | Il17c (Myc-DDK-tagged) - Mouse interleukin 17C (Il17c) |
CNY 2400.00 |
|
| MR222634L3 | Lenti ORF clone of Il17c (Myc-DDK-tagged) - Mouse interleukin 17C (Il17c) |
CNY 4750.00 |
|
| MR222634L4 | Lenti ORF clone of Il17c (mGFP-tagged) - Mouse interleukin 17C (Il17c) |
CNY 4750.00 |

