Lin28b (NM_001031772) Mouse Untagged Clone

CAT#: MC214667

Lin28b (untagged) - Mouse lin-28 homolog B (C. elegans) (Lin28b), (10ug)



  "NM_001031772" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2810403D23Rik; D030047M17Rik; Lin-28.2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214667 representing NM_001031772
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGAAGGCGGGGCAAGCAAAGGTGAAGAGCCAGAAAAACTGCCCGGGCTGGCAGAGGACGAACCCC
AGGTTCTGCATGGCACTGGCCACTGTAAATGGTTCAACGTGCGCATGGGATTCGGATTCATCTCCATGAT
AAGTCGAGAGGGAAATCCCTTGGATATTCCAGTGGATGTATTTGTACACCAAAGCAAACTATTCATGGAA
GGATTTAGAAGCTTGAAAGAAGGAGAGCCAGTGGAATTTACATTTAAAAAATCCCCCAAAGGCCTTGAGT
CAATACGGGTAACAGGCCCAGGTGGGAGCCCCTGCTTAGGAAGTGAAAGAAGACCTAAAGGGAAGACCCT
GCAAAAGAGAAAGCCAAAGGGAGATAGGTGGAGACGGCAGGATTTACTGATGGATCAGATGTGGACTGTG
CGAGAAGAAGAGTCCAGGATGATTCCAAGATGCTACAACTGTGGTGGTCTCGACCATCATGCTAAAGAAT
GCAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATGGTGGCCAACTGCCC
ACACAAGCTTGCCGCTCAGCTGCCCGCCAGTTCTCAGGGAAGACAGGAGGCAGAATCCCAGCCATGCAGC
TCTGCGGCACCAAGAGAAGTGGGAGGGGGGCATGGCTGCACAGTACTGTTTCCTCAGGAGGTGAAGTCAG
AAATGGCAGAGCACTCAGACAGGTCACCCCAAGAAGTTTCTTCCACGAAAGCGTTTGCAGCAATAGGAGA
GCAAAACAAAAAGGGGCCTTTGATTCAGAAACGGAAAAAGACTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001031772
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC089037, AAH89037
RefSeq Size 5411 bp
RefSeq ORF 816 bp
Locus ID 380669
UniProt ID Q45KJ6
Gene Summary Suppressor of microRNA (miRNA) biogenesis, including that of let-7 and possibly of miR107, miR-143 and miR-200c. Binds primary let-7 transcripts (pri-let-7), including pri-let-7g and pri-let-7a-1, and sequester them in the nucleolus, away from the microprocessor complex, hence preventing their processing into mature miRNA. Does not act on pri-miR21. The repression of let-7 expression is required for normal development and contributes to maintain the pluripotent state of embryonic stem cells by preventing let-7-mediated differentiation. When overexpressed, recruits ZCCHC11/TUT4 uridylyltransferase to pre-let-7 transcripts, leading to their terminal uridylation and degradation. This activity might not be relevant in vivo, as LIN28B-mediated inhibition of let-7 miRNA maturation appears to be ZCCHC11-independent. Interaction with target pre-miRNAs occurs via an 5'-GGAG-3' motif in the pre-miRNA terminal loop (By similarity). Mediates MYC-induced let-7 repression (PubMed:19211792). When overexpressed, may stimulate growth of carcinoma cell lines (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...