Mreg (NM_001005423) Mouse Untagged Clone
CAT＃: MC214698
Mreg (untagged) - Mouse melanoregulin (Mreg), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | dsu; Gm974; Wdt2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC214698 representing NM_001005423
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGCTGCGCCGCTGGCTACGGAGCGCCTGCTGCTGCTGCCCGTGCCGGTGCCTGGAGGAGCCCGCGC GGCCCGAGAAGGAGCCGCTGGTCAGTGGTAACAATCCGTATTCCTCCTTTGGAGCGACTCTGGAGAGGGA TGATGAGAAGAATTTATGGAGCATGCCTCATGACGTGTCCCACACAGAGGCGGATGACGATAGGATCTTG TATAATTTGATAGTCATTCGTAATCAGCAGACCAAAGACTCAGAGGAATGGCAAAGACTCAACTATGATA TCTACACCCTGCGGCAGATCCGCAGGGAAGTGAGGAACCGATGGAGACGAATCTTAGAGGACTTGGGCTT TCAAAGGGAAGCCGACTCTCTGTTGTCAGTGACCAAACTCAGCACCATGAGTGATTCTAAAAACACAAGG AAAGCCCGGGAGATGCTGTTAAAGCTGGCTGAAGAGACCTCTATCTTCCCCGCCAGCTGGGAGCTCTCCG AGAGGTACCTCTTGGTTGTGGACCGGCTCATTGCTCTCGATGCTGCTGAGGACTTCTTTAAGATTGCTAG CCAAATGTACCCCAAGAAACCTGGGGTCCCATGCCTGGTGGACGGCCAGAGAAAACTGCACTGCCTTCCA TTTCCAAGCCCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001005423 |
| Insert Size | 645 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001005423.2, NP_001005423.1 |
| RefSeq Size | 2493 bp |
| RefSeq ORF | 645 bp |
| Locus ID | 381269 |
| UniProt ID | Q6NVG5 |
| Gene Summary | Probably functions as cargo-recognition protein that couples cytoplasmic vesicles to the transport machinery (PubMed:22940130, PubMed:22275436, PubMed:30174147). Plays a role in hair pigmentation, a process that involves shedding of melanosome-containing vesicles from melanocytes, followed by phagocytosis of the melanosome-containing vesicles by keratinocytes (PubMed:15550542, PubMed:3410303, PubMed:22753477). Functions on melanosomes as receptor for RILP and the complex formed by RILP and DCTN1, and thereby contributes to retrograde melanosome transport from the cell periphery to the center (PubMed:22940130, PubMed:22275436). Overexpression causes accumulation of late endosomes and/or lysosomes at the microtubule organising center (MTOC) at the center of the cell (PubMed:19240024, PubMed:30174147). Probably binds cholesterol and requires the presence of cholesterol in membranes to function in microtubule-mediated retrograde organelle transport (PubMed:30174147). Binds phosphatidylinositol 3-phosphate, phosphatidylinositol 4-phosphate, phosphatidylinositol 5-phosphate and phosphatidylinositol 3,5-bisphosphate, but not phosphatidylinositol 3,4-bisphosphate or phosphatidylinositol 4,5-bisphosphate (PubMed:19240024). Required for normal phagosome clearing and normal activation of lysosomal enzymes in lysosomes from retinal pigment epithelium cells (PubMed:19240024). Required for normal degradation of the lipofuscin component N-retinylidene-N-retinylethanolamine (A2E) in the eye (PubMed:19240024). May function in membrane fusion and regulate the biogenesis of disk membranes of photoreceptor rod cells (Probable).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG215346 | Mreg (tGFP-tagged) - Mouse melanoregulin (Mreg), (10ug) |
CNY 2850.00 |
|
| MR215346 | Mreg (Myc-DDK-tagged) - Mouse melanoregulin (Mreg) |
CNY 2400.00 |
|
| MR215346L3 | Lenti ORF clone of Mreg (Myc-DDK-tagged) - Mouse melanoregulin (Mreg) |
CNY 4750.00 |
|
| MR215346L4 | Lenti ORF clone of Mreg (mGFP-tagged) - Mouse melanoregulin (Mreg) |
CNY 4750.00 |
