Mreg (NM_001005423) Mouse Untagged Clone

CAT#: MC214698

Mreg (untagged) - Mouse melanoregulin (Mreg), (10ug)



  "NM_001005423" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms dsu; Gm974; Wdt2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214698 representing NM_001005423
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGCTGCGCCGCTGGCTACGGAGCGCCTGCTGCTGCTGCCCGTGCCGGTGCCTGGAGGAGCCCGCGC
GGCCCGAGAAGGAGCCGCTGGTCAGTGGTAACAATCCGTATTCCTCCTTTGGAGCGACTCTGGAGAGGGA
TGATGAGAAGAATTTATGGAGCATGCCTCATGACGTGTCCCACACAGAGGCGGATGACGATAGGATCTTG
TATAATTTGATAGTCATTCGTAATCAGCAGACCAAAGACTCAGAGGAATGGCAAAGACTCAACTATGATA
TCTACACCCTGCGGCAGATCCGCAGGGAAGTGAGGAACCGATGGAGACGAATCTTAGAGGACTTGGGCTT
TCAAAGGGAAGCCGACTCTCTGTTGTCAGTGACCAAACTCAGCACCATGAGTGATTCTAAAAACACAAGG
AAAGCCCGGGAGATGCTGTTAAAGCTGGCTGAAGAGACCTCTATCTTCCCCGCCAGCTGGGAGCTCTCCG
AGAGGTACCTCTTGGTTGTGGACCGGCTCATTGCTCTCGATGCTGCTGAGGACTTCTTTAAGATTGCTAG
CCAAATGTACCCCAAGAAACCTGGGGTCCCATGCCTGGTGGACGGCCAGAGAAAACTGCACTGCCTTCCA
TTTCCAAGCCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001005423
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001005423.2, NP_001005423.1
RefSeq Size 2493 bp
RefSeq ORF 645 bp
Locus ID 381269
UniProt ID Q6NVG5
Gene Summary Probably functions as cargo-recognition protein that couples cytoplasmic vesicles to the transport machinery (PubMed:22940130, PubMed:22275436, PubMed:30174147). Plays a role in hair pigmentation, a process that involves shedding of melanosome-containing vesicles from melanocytes, followed by phagocytosis of the melanosome-containing vesicles by keratinocytes (PubMed:15550542, PubMed:3410303, PubMed:22753477). Functions on melanosomes as receptor for RILP and the complex formed by RILP and DCTN1, and thereby contributes to retrograde melanosome transport from the cell periphery to the center (PubMed:22940130, PubMed:22275436). Overexpression causes accumulation of late endosomes and/or lysosomes at the microtubule organising center (MTOC) at the center of the cell (PubMed:19240024, PubMed:30174147). Probably binds cholesterol and requires the presence of cholesterol in membranes to function in microtubule-mediated retrograde organelle transport (PubMed:30174147). Binds phosphatidylinositol 3-phosphate, phosphatidylinositol 4-phosphate, phosphatidylinositol 5-phosphate and phosphatidylinositol 3,5-bisphosphate, but not phosphatidylinositol 3,4-bisphosphate or phosphatidylinositol 4,5-bisphosphate (PubMed:19240024). Required for normal phagosome clearing and normal activation of lysosomal enzymes in lysosomes from retinal pigment epithelium cells (PubMed:19240024). Required for normal degradation of the lipofuscin component N-retinylidene-N-retinylethanolamine (A2E) in the eye (PubMed:19240024). May function in membrane fusion and regulate the biogenesis of disk membranes of photoreceptor rod cells (Probable).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...