Gon7 (NM_001142938) Mouse Untagged Clone
CAT#: MC215668
AK010878 (untagged) - Mouse cDNA sequence AK010878 (AK010878), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MGC25937; MGC60472 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC215668 representing NM_001142938
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTTTCGGGCGAGTACGTCGGTTGTGACGGGGAGCCGCAGCGGCTACGAGTGTCCTGTGAGGCGT CGGGAGACGCGGACCCTCTCCAGAGCCTGTCGGCGGGCGTGGTCCGGATGAAGGAGTTGGTAGCGGAGTT CTTCGGGACCCTAGTGGAGCAGGACGCGCAAGGCTTGGCGGAAGATCCGGACGACGCTTTGGATGGTGAT GATGAAGATGATGCAGAAGATGAAAATAACTCTGGTAGAACTAACTCAGATGGACCATCTGCAAAACGTC CAAAGCCAGCATCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142938 |
Insert Size | 297 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142938.1, NP_001136410.1 |
RefSeq Size | 1162 bp |
RefSeq ORF | 297 bp |
Locus ID | 100233175 |
UniProt ID | P0C8B4 |
Gene Summary | Component of the EKC/KEOPS complex that is required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine. The complex is probably involved in the transfer of the threonylcarbamoyl moiety of threonylcarbamoyl-AMP (TC-AMP) to the N6 group of A37. GON7 likely plays a supporting role to the catalytic subunit OSGEP in the complex.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG213110 | AK010878 (tGFP-tagged) - Mouse hypothetical protein LOC100233175 (LOC100233175) transcript variant 1, (10ug) |
CNY 2850.00 |
|
MR213110 | AK010878 (Myc-DDK-tagged) - Mouse cDNA sequence AK010878 (AK010878), transcript variant 1 |
CNY 1200.00 |
|
MR213110L3 | Lenti ORF clone of AK010878 (Myc-DDK-tagged) - Mouse cDNA sequence AK010878 (AK010878), transcript variant 1 |
CNY 4750.00 |
|
MR213110L4 | Lenti ORF clone of AK010878 (mGFP-tagged) - Mouse cDNA sequence AK010878 (AK010878), transcript variant 1 |
CNY 4750.00 |