Park2 (NM_016694) Mouse Untagged Clone
CAT#: MC216304
Park2 (untagged) - Mouse Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2), (10ug)
CNY 5488.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | PRKN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC216304 representing NM_016694
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATAGTGTTTGTCAGGTTCAACTCCAGCTATGGCTTCCCAGTGGAGGTCGATTCTGACACCAGCATCT TGCAGCTCAAGGAAGTGGTTGCTAAGCGACAGGGGGTTCCAGCTGACCAGCTGCGTGTGATTTTTGCCGG GAAGGAGCTTCCGAATCACCTGACGGTTCAAAACTGTGACCTGGAACAACAGAGTATTGTACACATAGTA CAGAGACCACGGAGGAGAAGTCATGAAACAAATGCATCTGGAGGGGACGAACCCCAGAGCACCTCAGAGG GCTCCATATGGGAGTCCAGGAGCTTGACACGAGTGGACCTGAGCAGCCATACCCTGCCGGTGGACTCTGT GGGGCTGGCGGTCATTCTGGACACAGACAGTAAGAGGGATTCAGAAGCAGCCAGAGGTCCAGTTAAACCC ACCTACAACAGCTTTTTCATCTACTGCAAAGGCCCCTGCCACAAGGTCCAGCCTGGAAAGCTCCGAGTTC AGTGTGGCACCTGCAAACAAGCAACCCTCACCTTGGCCCAGGGCCCATCTTGCTGGGACGATGTCTTAAT TCCAAACCGGATGAGTGGTGAGTGCCAGTCTCCAGACTGCCCTGGAACCAGAGCTGAATTTTTCTTTAAA TGTGGAGCACACCCAACCTCAGACAAGGACACGTCGGTAGCTTTGAACCTGATCACCAGCAACAGGCGCA GCATCCCTTGCATAGCGTGCACAGATGTCAGGAGCCCTGTCCTGGTCTTCCAGTGTAACCACCGTCACGT GATCTGTTTGGACTGTTTCCACTTGTATTGTGTCACAAGACTCAACGATCGGCAGTTTGTCCACGATGCT CAACTTGGCTACTCCCTGCCGTGTGTAGCTGGCTGTCCCAACTCCCTGATTAAAGAGCTCCATCACTTCA GGATCCTTGGAGAAGAGCAGTACACTAGGTACCAGCAGTATGGGGCCGAGGAATGCGTGCTGCAAATGGG AGGTGTGCTGTGCCCCCGTCCTGGCTGTGGAGCTGGACTGCTACCTGAACAGGGCCAGAGGAAAGTCACC TGCGAAGGGGGCAACGGCCTGGGCTGCGGGTTTGTTTTCTGCCGGGACTGTAAGGAAGCATACCATGAAG GGGATTGCGACTCACTGCTCGAACCCTCAGGAGCCACTTCTCAGGCCTACAGGGTGGACAAAAGAGCCGC TGAGCAAGCTCGCTGGGAGGAGGCCTCCAAGGAAACCATCAAGAAGACCACCAAGCCTTGTCCTCGCTGC AACGTGCCAATTGAAAAAAACGGAGGATGTATGCACATGAAGTGTCCTCAGCCCCAGTGCAAGCTGGAGT GGTGCTGGAACTGTGGCTGTGAGTGGAACCGAGCCTGCATGGGAGATCACTGGTTTGACGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_016694 |
Insert Size | 1395 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC113204, AAI13205 |
RefSeq Size | 2699 bp |
RefSeq ORF | 1395 bp |
Locus ID | 50873 |
UniProt ID | Q9WVS6 |
Gene Summary | Functions within a multiprotein E3 ubiquitin ligase complex, catalyzing the covalent attachment of ubiquitin moieties onto substrate proteins, such as BCL2, SYT11, CCNE1, GPR37, RHOT1/MIRO1, MFN1, MFN2, STUB1, SNCAIP, SEPTIN5, TOMM20, USP30, ZNF746 and AIMP2. Mediates monoubiquitination as well as 'Lys-6', 'Lys-11', 'Lys-48'-linked and 'Lys-63'-linked polyubiquitination of substrates depending on the context. Participates in the removal and/or detoxification of abnormally folded or damaged protein by mediating 'Lys-63'-linked polyubiquitination of misfolded proteins such as PARK7: 'Lys-63'-linked polyubiquitinated misfolded proteins are then recognized by HDAC6, leading to their recruitment to aggresomes, followed by degradation. Mediates 'Lys-63'-linked polyubiquitination of a 22 kDa O-linked glycosylated isoform of SNCAIP, possibly playing a role in Lewy-body formation. Mediates monoubiquitination of BCL2, thereby acting as a positive regulator of autophagy. Promotes the autophagic degradation of dysfunctional depolarized mitochondria (mitophagy) by promoting the ubiquitination of mitochondrial proteins such as TOMM20, RHOT1/MIRO1 and USP30. Preferentially assembles 'Lys-6'-, 'Lys-11'- and 'Lys-63'-linked polyubiquitin chains following mitochondrial damage, leading to mitophagy. Mediates 'Lys-48'-linked polyubiquitination of ZNF746, followed by degradation of ZNF746 by the proteasome; possibly playing a role in the regulation of neuron death. Limits the production of reactive oxygen species (ROS). Regulates cyclin-E during neuronal apoptosis. In collaboration with CHPF isoform 2, may enhance cell viability and protect cells from oxidative stress. Independently of its ubiquitin ligase activity, protects from apoptosis by the transcriptional repression of p53/TP53. May protect neurons against alpha synuclein toxicity, proteasomal dysfunction, GPR37 accumulation, and kainate-induced excitotoxicity. May play a role in controlling neurotransmitter trafficking at the presynaptic terminal and in calcium-dependent exocytosis. May represent a tumor suppressor gene.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
In Vitro Comparison of the Activity Requirements and Substrate Specificity of Human and Triboleum castaneum PINK1 Orthologues
,Aerts, L;Craessaerts, K;De Strooper, B;Morais, VA;,
PLoS ONE
,PubMed ID 26784449
[PARK2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227497 | Park2 (tGFP-tagged) - Mouse Parkinson disease (autosomal recessive juvenile) 2 parkin (Park2), (10ug) |
CNY 7088.00 |
|
MR227497 | Park2 (Myc-DDK-tagged) - Mouse Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) |
CNY 5488.00 |
|
MR227497L1 | Lenti ORF clone of Park2 (Myc-DDK-tagged) - Mouse Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) |
CNY 7888.00 |
|
MR227497L2 | Lenti ORF clone of Park2 (mGFP-tagged) - Mouse Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) |
CNY 7888.00 |
|
MR227497L3 | Lenti ORF clone of Park2 (Myc-DDK-tagged) - Mouse Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) |
CNY 7888.00 |
|
MR227497L4 | Lenti ORF clone of Park2 (mGFP-tagged) - Mouse Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) |
CNY 7888.00 |