Stk4 (NM_021420) Mouse Untagged Clone

CAT#: MC216774

Stk4 (untagged) - Mouse serine/threonine kinase 4 (Stk4), (10ug)



  "NM_021420" in other vectors (4)

CNY 6370.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI447339; AU020804; Kas-2; Mst1; Ysk3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216774 representing NM_021420
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGACCGTGCAGCTGAGGAACCCACCGCGCAGGCAGCTGAAAAAGTTGGATGAAGATAGTTTAACCA
AGCAGCCCGAGGAAGTGTTTGATGTCTTAGAGAAGCTTGGAGAGGGGTCTTATGGCAGCGTGTACAAGGC
TATTCATAAAGAGACTGGCCAGATTGTTGCAATCAAGCAAGTGCCCGTGGAATCGGACCTGCAGGAGATA
ATCAAGGAAATCTCCATCATGCAGCAGTGTGACAGCCCTCACGTAGTCAAGTATTATGGCAGCTACTTTA
AGAACACAGACCTGTGGATTGTTATGGAGTACTGTGGGGCTGGTTCTGTATCTGATATCATTCGGCTACG
GAACAAGACGTTAACAGAAGATGAAATAGCTACAATATTACAATCAACTCTTAAGGGACTAGAATACCTT
CATTTTATGAGAAAAATACACCGAGATATCAAGGCGGGAAATATTTTGCTAAACACAGAAGGCCATGCAA
AGCTTGCAGACTTTGGAGTCGCAGGTCAACTTACAGATACCATGGCAAAGAGGAATACAGTAATAGGGAC
CCCGTTTTGGATGGCTCCTGAAGTTATTCAGGAAATTGGGTACAACTGTGTGGCAGACATCTGGTCTCTG
GGAATAACTGCCATAGAAATGGCTGAAGGAAAGCCCCCATATGCTGATATCCATCCAATGAGGGCAATAT
TCATGATTCCTACAAACCCTCCTCCCACATTCCGTAAGCCAGAGCTGTGGTCAGACAACTTCATGGATTT
TGTGAAGCAGTGTCTGGTAAAAAGCCCGGAGCAGAGAGCCACAGCCACTCAGCTCCTACAGCACCCGTTT
GTTAAGAGTGCCAAAGGAGTGTCAATATTGCGAGACTTAATTAACGAAGCCATGGATGTGAAACTGAAGC
GCCAGGAAGCCCAGCAGCGGGAAGTGGACCAGGACGACGAGGAGAACTCAGAGGAGGATGAAATGGATTC
CGGCACGATGGTTCGAGCTGCCGGTGATGAGATGGGCACTGTCCGAGTAGCCAGCACGATGAGCGGAGGA
GCCAATACTATGATTGAGCACGGTGACACGTTGCCGTCCCAGCTGGGCACCATGGTGATCAACACGGAGG
ACGAGGAAGAGGAAGGAACCATGAAAAGAAGAGATGAGACCATGCAGCCTGCAAAACCGTCTTTCCTTGA
ATACTTTGAACAAAAAGAAAAGGAAAATCAGATCAACAGCTTTGGCAAGAATGTATCTGGCTCTCTGAAG
AATTCTTCCGATTGGAAAATCCCTCAGGATGGAGACTATGAGTTTCTCAAGAGCTGGACTGTGGAGGACC
TTCAGAAGAGGCTCTTGGCCCTCGACCCCATGATGGAACAGGAAATGGAAGAGATCCGGCAGAAGTACCG
GTCCAAGCGGCAGCCAATCCTGGATGCCATTGAAGCCAAGAAGAGGAGGCAACAGAACTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021420
Insert Size 1464 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021420.3, NP_067395.1
RefSeq Size 5189 bp
RefSeq ORF 1464 bp
Locus ID 58231
UniProt ID Q9JI11
Gene Summary Stress-activated, pro-apoptotic kinase which, following caspase-cleavage, enters the nucleus and induces chromatin condensation followed by internucleosomal DNA fragmentation. Key component of the Hippo signaling pathway which plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. STK3/MST2 and STK4/MST1 are required to repress proliferation of mature hepatocytes, to prevent activation of facultative adult liver stem cells (oval cells), and to inhibit tumor formation. Phosphorylates 'Ser-14' of histone H2B (H2BS14ph) during apoptosis. Phosphorylates FOXO3 upon oxidative stress, which results in its nuclear translocation and cell death initiation. Phosphorylates MOBKL1A, MOBKL1B and RASSF2. Phosphorylates TNNI3 (cardiac Tn-I) and alters its binding affinity to TNNC1 (cardiac Tn-C) and TNNT2 (cardiac Tn-T). Phosphorylates FOXO1 on 'Ser-212' and regulates its activation and stimulates transcription of PMAIP1 in a FOXO1-dependent manner. Phosphorylates SIRT1 and inhibits SIRT1-mediated p53/TP53 deacetylation, thereby promoting p53/TP53 dependent transcription and apoptosis upon DNA damage. Acts as an inhibitor of PKB/AKT1. Phosphorylates AR on 'Ser-650' and suppresses its activity by intersecting with PKB/AKT1 signaling and antagonizing formation of AR-chromatin complexes (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...