Egr1 (NM_007913) Mouse Untagged Clone
CAT#: MC217560
Egr1 (untagged) - Mouse early growth response 1 (Egr1), (10ug)
CNY 3976.00
CNY 6840.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A530045N19Rik; egr; Egr-1; ETR103; Krox-1; Krox-24; Krox24; NGF1-A; NGFI-A; NGFIA; TIS8; Zenk; Zfp-6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_007913, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGGCCAAGGCCGAGATGCAATTGATGTCTCCGCTGCAGATCTCTGACCCGTTCGGCTCCTTTC CTCACTCACCCACCATGGACAACTACCCCAAACTGGAGGAGATGATGCTGCTGAGCAACGGGGCTCCCCA GTTCCTCGGTGCTGCCGGAACCCCAGAGGGCAGCGGCGGTAATAGCAGCAGCAGCACCAGCAGCGGGGGC GGTGGTGGGGGCGGCAGCAACAGCGGCAGCAGCGCCTTCAATCCTCAAGGGGAGCCGAGCGAACAACCCT ATGAGCACCTGACCACAGAGTCCTTTTCTGACATCGCTCTGAATAATGAGAAGGCGATGGTGGAGACGAG TTATCCCAGCCAAACGACTCGGTTGCCTCCCATCACCTATACTGGCCGCTTCTCCCTGGAGCCCGCACCC AACAGTGGCAACACTTTGTGGCCTGAACCCCTTTTCAGCCTAGTCAGTGGCCTCGTGAGCATGACCAATC CTCCGACCTCTTCATCCTCGGCGCCTTCTCCAGCTGCTTCATCGTCTTCCTCTGCCTCCCAGAGCCCGCC CCTGAGCTGTGCCGTGCCGTCCAACGACAGCAGTCCCATCTACTCGGCTGCGCCCACCTTTCCTACTCCC AACACTGACATTTTTCCTGAGCCCCAAAGCCAGGCCTTTCCTGGCTCGGCAGGCACAGCCTTGCAGTACC CGCCTCCTGCCTACCCTGCCACCAAAGGTGGTTTCCAGGTTCCCATGATCCCTGACTATCTGTTTCCACA ACAACAGGGAGACCTGAGCCTGGGCACCCCAGACCAGAAGCCCTTCCAGGGTCTGGAGAACCGTACCCAG CAGCCTTCGCTCACTCCACTATCCACTATTAAAGCCTTCGCCACTCAGTCGGGCTCCCAGGACTTAAAGG CTCTTAATACCACCTACCAATCCCAGCTCATCAAACCCAGCCGCATGCGCAAGTACCCCAACCGGCCCAG CAAGACACCCCCCCATGAACGCCCATATGCTTGCCCTGTCGAGTCCTGCGATCGCCGCTTTTCTCGCTCG GATGAGCTTACCCGCCATATCCGCATCCACACAGGCCAGAAGCCCTTCCAGTGTCGAATCTGCATGCGTA ACTTCAGTCGTAGTGACCACCTTACCACCCACATCCGCACCCACACAGGCGAGAAGCCTTTTGCCTGTGA CATTTGTGGGAGGAAGTTTGCCAGGAGTGATGAACGCAAGAGGCATACCAAAATCCATTTAAGACAGAAG GACAAGAAAGCAGACAAAAGTGTGGTGGCCTCCCCGGCTGCCTCTTCACTCTCTTCTTACCCATCCCCAG TGGCTACCTCCTACCCATCCCCTGCCACCACCTCATTCCCATCCCCTGTGCCCACTTCCTACTCCTCTCC TGGCTCCTCCACCTACCCATCTCCTGCGCACAGTGGCTTCCCGTCGCCGTCAGTGGCCACCACCTTTGCC TCCGTTCCACCTGCTTTCCCCACCCAGGTCAGCAGCTTCCCGTCTGCGGGCGTCAGCAGCTCCTTCAGCA CCTCAACTGGTCTTTCAGACATGACAGCGACCTTTTCTCCCAGGACAATTGAAATTTGCTAA |
| Restriction Sites | AscI-MluI |
| ACCN | NM_007913 |
| Insert Size | 1602 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC138613, AAI38614 |
| RefSeq Size | 1978 bp |
| RefSeq ORF | 1602 bp |
| Locus ID | 13653 |
| UniProt ID | P08046 |
| Gene Summary | Transcriptional regulator (PubMed:8336701, PubMed:8703054, PubMed:15958557). Recognizes and binds to the DNA sequence 5'-GCG(T/G)GGGCG-3'(EGR-site) in the promoter region of target genes (PubMed:8703054, PubMed:15958557, PubMed:2028256, PubMed:8939742). Binds double-stranded target DNA, irrespective of the cytosine methylation status (By similarity). Regulates the transcription of numerous target genes, and thereby plays an important role in regulating the response to growth factors, DNA damage, and ischemia (PubMed:11100120, PubMed:15958557). Plays a role in the regulation of cell survival, proliferation and cell death (PubMed:15265859, PubMed:15958557). Activates expression of p53/TP53 and TGFB1, and thereby helps prevent tumor formation (PubMed:15958557). Required for normal progress through mitosis and normal proliferation of hepatocytes after partial hepatectomy (PubMed:15265859). Mediates responses to ischemia and hypoxia; regulates the expression of proteins such as IL1B and CXCL2 that are involved in inflammatory processes and development of tissue damage after ischemia (PubMed:11100120). Regulates biosynthesis of luteinizing hormone (LHB) in the pituitary (PubMed:8703054). Regulates the amplitude of the expression rhythms of clock genes: ARNTL/BMAL1, PER2 and NR1D1 in the liver via the activation of PER1 (clock repressor) transcription (PubMed:26471974). Regulates the rhythmic expression of core-clock gene ARNTL/BMAL1 in the suprachiasmatic nucleus (SCN) (PubMed:29138967).[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A mechanism of cooling hot tumors: Lactate attenuates inflammation in dendritic cells
,null,
iScience
,PubMed ID 34541473
[Egr1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227136 | Egr1 (tGFP-tagged) - Mouse early growth response 1 (Egr1), (10ug) |
CNY 5568.00 |
|
| MR227136 | Egr1 (Myc-DDK-tagged) - Mouse early growth response 1 (Egr1) |
CNY 3968.00 |
|
| MR227136L3 | Lenti ORF clone of Egr1 (Myc-DDK-tagged) - Mouse early growth response 1 (Egr1) |
CNY 6368.00 |
|
| MR227136L4 | Lenti ORF clone of Egr1 (mGFP-tagged) - Mouse early growth response 1 (Egr1) |
CNY 6368.00 |
