Eif4h (BC014796) Mouse Untagged Clone
CAT#: MC217765
Eif4h (untagged) - Mouse eukaryotic translation initiation factor 4H (cDNA clone MGC:11689 IMAGE:3962104), (10ug)
CNY 6940.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Wscr1, mKIAA0038, Ef4h |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC014796
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGACTTCGATACCTACGACGATCGGGCCTACAGCAGCTTCGGCGGCGGTAGAGGGTCCCGAGGCA GTGCTGGTGGCCATGGGTCCCGGAGCCAGAAGGAGCTACCCACAGAGCCCCCCTACACAGCTTACGTAGG AAATCTCCCTTTTAACACAGTTCAGGGTGACATAGATGCTATCTTTAAGGATCTCAGCATACGGAGTGTG CGGCTAGTCAGAGACAAAGACACAGACAAATTTAAAGGGTTCTGCTATGTAGAATTTGATGAGGTGGATT CCCTGAAGGAGGCTCTGACTTATGACGGTGCACTCTTGGGTGACCGGTCACTTCGTGTGGACATTGCAGA AGGCAGAAAACAAGATAAAGGTGGCTTTGGATTCAGGAAAGGTGGACCTGATGACAGAGGCTACAGGGAT GACTTCTTAGGGGGTAGGGGGGGCAGTCGCCCTGGGGACCGGCGAGCAGGCCCTCCAATGGGGAGTCGCT TTCGAGATGGCCCTCCTCTGCGTGGCTCCAACATGGACTTCAGAGAACCCACAGAAGAGGAACGAGCACA GAGACCTCGGCTGCAGCTTAAACCTCGGACAGTGGCAACGCCCCTCAATCAAGTAGCCAACCCCAACTCA GCCATCTTTGGGGGAGCCAGGCCCAGAGAGGAAGTGGTTCAGAAGGAGCAAGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC014796 |
| Insert Size | 687 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC014796, AAH14796 |
| RefSeq Size | 2374 bp |
| RefSeq ORF | 686 bp |
| Locus ID | 22384 |
| Gene Summary | This gene encodes eukaryotic translation initiation factor 4H (eIF4H) that plays a critical role in the process of protein synthesis. The encoded protein is an RNA-binding protein that, in concert with other translation initiation factors, helps unwind the 5' cap-proximal region of mRNA to prepare it for ribosomal attachment. Mice lacking the encoded protein displayed growth retardation with a significant reduction of body weight, a smaller brain volume and altered brain morphology. Behaviorally, mice lacking the encoded protein exhibit severe impairments of fear-related associative learning and memory formation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202724 | Eif4h (tGFP-tagged) - Mouse eukaryotic translation initiation factor 4H (cDNA clone MGC:11689 IMAGE:3962104) |
CNY 2850.00 |
|
| MR202724 | Eif4h (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4H (cDNA clone MGC:11689 IMAGE:3962104) |
CNY 2400.00 |
|
| MR202724L3 | Lenti ORF clone of Eif4h (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4H (cDNA clone MGC:11689 IMAGE:3962104) |
CNY 4750.00 |
|
| MR202724L4 | Lenti ORF clone of Eif4h (mGFP-tagged) - Mouse eukaryotic translation initiation factor 4H (cDNA clone MGC:11689 IMAGE:3962104) |
CNY 4750.00 |
