Spc25 (BC027121) Mouse Untagged Clone
CAT#: MC217821
Spc25 (untagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (cDNA clone MGC:38808 IMAGE:5359960),, (10ug)
CNY 6940.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2600017H08Rik; 2610205L13Rik; Spbc25 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027121
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTGAAGACGAATTGGCACTCTTAAATCAAAGCATCAATGAATTTGGGGATAAGTTCAGAAACAGAC TCGATGATAATCATAGTCAAGTGCTGGGACTTAGAGACGCCTTCAAGGACTCCATGAAAGCGTTTTCAGA AAAGATGTCTTTGAAATTAAAGGAAGAAGAGAGGATGACTGAGATGATTCTGGAGTATAAAAACCAGCTC TGTAAGCAGAATAAGCTCATTCAAGAAAAGAAAGAGAATGTGTTGAAGATGATTGCTGAAGTAAAAGGCA AGGAGCAAGAGTCGGAAGAGCTGACTGCTAAAATCCAGGAGCTCAAGGAAGAGTACGCTAGGAAGAGGGA AACCATTTCCACTGCTAACAAAGCTAATGAAGAGAGATTGAAAGGACTGCAGAAATCAGCGGATCTGTAT AGAGATTACCTTGGACTAGAAATTAGAAAGATTCACGGTAATAAATTGCAGTTTATATTTACTAGTATTG ACCCTAAGAATCCTGAGAGCCCATATATGTTTTCCATGAGCATAAATGAAGCTAAGGAATATGAAGTGTA CGACAGTTCGCCTCATCTTGAGTGCCTAGCAGAATTTCAGGAGAAAGTCAGGAAGACCAACAATTTTTCA GCTTTTCTTGCCAATATTCGGAAGGCTTTTATAGCTAAGGTTCATAATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC027121 |
| Insert Size | 681 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027121, AAH27121 |
| RefSeq Size | 1344 bp |
| RefSeq ORF | 680 bp |
| Locus ID | 66442 |
| Gene Summary | This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202652 | Spc25 (tGFP-tagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (cDNA clone MGC:38808 IMAGE:5359960) |
CNY 2850.00 |
|
| MR202652 | Spc25 (Myc-DDK-tagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (cDNA clone MGC:38808 IMAGE:5359960) |
CNY 2400.00 |
|
| MR202652L3 | Lenti ORF clone of Spc25 (Myc-DDK-tagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (cDNA clone MGC:38808 IMAGE:5359960) |
CNY 4750.00 |
|
| MR202652L4 | Lenti ORF clone of Spc25 (mGFP-tagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (cDNA clone MGC:38808 IMAGE:5359960) |
CNY 4750.00 |
