Znrf1 (NM_133206) Mouse Untagged Clone
CAT#: MC218756
Znrf1 (untagged) - Mouse zinc and ring finger 1 (Znrf1), transcript variant 1, (10ug)
CNY 6940.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | B830022L21Rik; nin283; Rnf42; Zrfp1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC218756 representing NM_133206
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGGCAAGCAGAGCACGGCGGCCCGCTCTCGGGGCCCCTTCCCGGGGGTCTCTACGGATGACAGCG CCGTGCCGCCGCCGGGAGGGGCGCCCCACTTTGGGCACTACCGGACGGGCGGCGGGGCGATGGGGCTGCG CAGCCGCTCGGTCAGCTCGGTGGCGGGCATGGGCATGGACCCCAGCACGGCCGGAGGGGTGCCCTTTAGT CTCTACACCCCCGCCTCCCGCGGGACCGGCGACTCCGAGAGGGCGCCGGGCGGCGGAGGGTCCACGTCGG ACTCCACCTATGCCCACGGCAATGGTTACCAAGAGACCGGCGGCGGTCACCATAGAGACGGGATGCTGTA CCTGGGCTCCCGAGCCTCGCTGGCGGATGCTCTACCTCTGCACATCGCACCCAGGTGGTTCAGCTCGCAC AGTGGTTTCAAGTGCCCCATTTGTTCCAAGTCTGTGGCTTCCGATGAGATGGAAATGCACTTTATAATGT GTCTGAGCAAGCCTCGCCTGTCCTACAATGATGATGTGCTGACTAAAGATGCGGGTGAGTGTGTGATCTG CCTGGAGGAGCTGCTTCAGGGGGACACGATAGCCAGGCTGCCTTGCCTGTGCATCTATCACAAAAGCTGC ATAGACTCATGGTTTGAAGTGAACAGATCTTGTCCAGAGCACCCTGCTGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_133206 |
Insert Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_133206.3, NP_573469.1 |
RefSeq Size | 5562 bp |
RefSeq ORF | 684 bp |
Locus ID | 170737 |
UniProt ID | Q91V17 |
Gene Summary | E3 ubiquitin-protein ligase that mediates the ubiquitination of AKT1 and GLUL, thereby playing a role in neuron cells differentiation. Plays a role in the establishment and maintenance of neuronal transmission and plasticity. Regulates Schwann cells differentiation by mediating ubiquitination of GLUL. Promotes Wallerian degeneration, a neurodegeneration disorder, by mediating 'Lys-48'-linked polyubiquitination and subsequent degradation of AKT1 in axons: degradation of AKT1 prevents AKT1-mediated phosphorylation of GSK3B, leading to GSK3B activation and phosphorylation of DPYSL2/CRMP2 followed by destabilization of microtubule assembly in axons.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1, 2, and 5 all encode the same isoform (a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC200768 | Znrf1 (untagged) - Mouse zinc and ring finger 1 (Znrf1), transcript variant 1, (10ug) |
CNY 2400.00 |
|
MG202714 | Znrf1 (tGFP-tagged) - Mouse zinc and ring finger 1 (Znrf1) |
CNY 2850.00 |
|
MG216517 | Znrf1 (tGFP-tagged) - Mouse zinc and ring finger 1 (Znrf1) transcript variant 1, (10ug) |
CNY 2850.00 |
|
MR216517 | Znrf1 (Myc-DDK-tagged) - Mouse zinc and ring finger 1 (Znrf1), transcript variant 1 |
CNY 2400.00 |
|
MR216517L3 | Lenti ORF clone of Znrf1 (Myc-DDK-tagged) - Mouse zinc and ring finger 1 (Znrf1), transcript variant 1 |
CNY 4750.00 |
|
MR216517L4 | Lenti ORF clone of Znrf1 (mGFP-tagged) - Mouse zinc and ring finger 1 (Znrf1), transcript variant 1 |
CNY 4750.00 |