Cttn (NM_007803) Mouse Untagged Clone
CAT#: MC218796
Cttn (untagged) - Mouse cortactin (Cttn), (10ug)
CNY 4072.00
CNY 7030.00
货期*
现货
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110020L01Rik; Ems1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC218796 representing NM_007803
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_007803 |
Insert Size | 1641 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007803.4, NP_031829.2 |
RefSeq Size | 3029 bp |
RefSeq ORF | 1641 bp |
Locus ID | 13043 |
UniProt ID | Q60598 |
Gene Summary | Contributes to the organization of the actin cytoskeleton and cell shape (PubMed:17403031). Plays a role in the formation of lamellipodia and in cell migration (By similarity). Plays a role in the regulation of neuron morphology, axon growth and formation of neuronal growth cones (By similarity). Through its interaction with CTTNBP2, involved in the regulation of neuronal spine density (PubMed:22262902). Plays a role in the invasiveness of cancer cells, and the formation of metastases (By similarity). Plays a role in focal adhesion assembly and turnover (By similarity). In complex with ABL1 and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement (By similarity). Plays a role in intracellular protein transport and endocytosis, and in modulating the levels of potassium channels present at the cell membrane (PubMed:17959782). Plays a role in receptor-mediated endocytosis via clathrin-coated pits (By similarity). Required for stabilization of KCNH1 channels at the cell membrane (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and it encodes the longest protein (isoform 1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...