Ubqln1 (NM_152234) Mouse Untagged Clone

CAT#: MC218923

Ubqln1 (untagged) - Mouse ubiquilin 1 (Ubqln1), transcript variant 2, (10ug)



  "NM_152234" in other vectors (4)

CNY 7130.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110046H03Rik; 1810030E05Rik; AU019746; C77538; D13Ertd372e; Da41; Dsk2; Plic-1; Plic1; Xdrp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218923 representing NM_152234
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGAGAGCGCAGAGAGCGGCGGCCCACCGGGCGCGCAGGACAGTGCGGCCGACGGCGGCCCCGCAG
AGCCCAAGATCATGAAGGTCACGGTGAAGACGCCTAAAGAGAAGGAGGAGTTTGCCGTGCCCGAGAACAG
CTCGGTCCAGCAGTTCAAAGAGGAAATCTCTAAACGTTTCAAATCTCATATTGACCAACTTGTGTTGATA
TTTGCTGGAAAAATTTTAAAAGATCAAGATACTCTGAGTCAGCATGGGATTCATGATGGACTTACGGTTC
ACCTTGTCATCAAAACACAGAACAGGCCGCAAGATAATTCAGCTCAGCAAACAAATGCCCCTGGAAGCAC
TGTGACCAGCTCACCAGCTCCCGATAGCAACCCCACGTCTGGTTCTGCTGCTAACAGCTCCTTTGGCGTA
GGCGGACTTGGAGGACTTGCAGGTCTTAGCAGCTTGGGTTTAAACACCACCAACTTCTCTGAACTCCAGA
GCCAAATGCAGCGGCAACTTTTGTCTAACCCTGAAATGATGGTCCAGATCATGGAAAATCCCTTTGTCCA
GAGCATGCTCTCAAATCCTGACCTGATGCGGCAATTGATTATGGCCAATCCACAGATGCAACAGTTGATA
CAGAGAAATCCAGAGATTAGTCATATGCTTAATAATCCAGATATAATGAGACAAACACTGGAACTTGCGA
GAAATCCAGCGATGATGCAGGAAATGATGAGAAACCAGGACCGAGCCTTGAGCAACCTAGAAAGTATTCC
TGGGGGCTATAATGCCTTACGGCGCATGTACACCGATATCCAGGAGCCTATGCTGAATGCTGCTCAAGAA
CAGTTTGGTGGTAATCCATTTGCGTCCTTAGTGAGCAGTTCGTCCTCAGCAGAAGGGACTCAGCCTTCTC
GAACAGAAAATAGGGATCCGCTCCCCAACCCGTGGGCTCCGCAGACTTCCCAGAGCTCACCAGCCTCCGG
TACCACTGGCAGCACCACTAACACCATGAGCACCTCTGGTGGCACTGCCACCAGTACCCCTGCTGGACAG
AGCACCTCGGGCCCAAGCTTGGTGCCTGGCGCAGGAGCTAGTATGTTCAACACCCCCGGAATGCAGAGCC
TGCTGCAGCAGATAACTGAGAACCCACAGCTCATGCAGAACATGCTGTCCGCCCCATACATGAGGAGCAT
GCTGCAGTCCCTGAGCCAGAACCCCGACCTTGCTGCGCAGATGCAGAACCCCGACACGCTCTCAGCGATG
TCGAATCCTAGAGCCATGCAGGCGCTGCTGCAGATCCAGCAGGGCTTGCAGACGCTGGCCACAGAAGCTC
CTGGCCTCATCCCAGGGTTTACTCCTGGCTTGGCAGCAGGCAATTCTGGAGGCTCTTCCGGAACCAATGC
ACCTAGCACTGCACCTAGTGAAGATACGAACCCCCAAGGGGGCACTGCTGAGCCAGGCCACCAGCAGTTT
ATCCAGCAGATGCTGCAGGCCCTTGCGGGGGTGAATCCTCAGCTGCAGAGTCCAGAAGTCAGATTTCAGC
AACAACTGGAACAACTCAGTGCCATGGGATTCTTGAACCGTGAAGCAAACCTGCAAGCTCTGATAGCCAC
AGGGGGCGACATCAATGCAGCAATCGAAAGGTTGCTGGGCTCCCAGCCGTCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_152234
Insert Size 1665 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_152234.2, NP_689420.1
RefSeq Size 3609 bp
RefSeq ORF 1665 bp
Locus ID 56085
UniProt ID Q8R317
Gene Summary Plays an important role in the regulation of different protein degradation mechanisms and pathways including ubiquitin-proteasome system (UPS), autophagy and endoplasmic reticulum-associated protein degradation (ERAD) pathway. Mediates the proteasomal targeting of misfolded or accumulated proteins for degradation by binding (via UBA domain) to their polyubiquitin chains and by interacting (via ubiquitin-like domain) with the subunits of the proteasome. Plays a role in the ERAD pathway via its interaction with ER-localized proteins UBXN4, VCP and HERPUD1 and may form a link between the polyubiquitinated ERAD substrates and the proteasome. Plays a role in unfolded protein response (UPR) by attenuating the induction of UPR-inducible genes, DDTI3/CHOP, HSPA5 and PDIA2 during ER stress. Involved in the regulation of macroautophagy and autophagosome formation; required for maturation of autophagy-related protein LC3 from the cytosolic form LC3-I to the membrane-bound form LC3-II and may assist in the maturation of autophagosomes to autolysosomes by mediating autophagosome-lysosome fusion. Negatively regulates the TICAM1/TRIF-dependent toll-like receptor signaling pathway by decreasing the abundance of TICAM1 via the autophagic pathway. Plays a key role in the regulation of the levels of PSEN1 by targeting its accumulation to aggresomes which may then be removed from cells by autophagocytosis. Promotes the ubiquitination and lysosomal degradation of ORAI1, consequently downregulating the ORAI1-mediated Ca2+ mobilization. Suppresses the maturation and proteasomal degradation of amyloid beta A4 protein (A4) by stimulating the lysine 63 (K63)-linked polyubiquitination. Delays the maturation of A4 by sequestering it in the Golgi apparatus and preventing its transport to the cell surface for subsequent processing (By similarity). Links CD47 to the cytoskeleton (PubMed:10549293).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...