Fgfr2 (NM_201601) Mouse Untagged Clone
CAT#: MC221076
Fgfr2 (untagged) - Mouse fibroblast growth factor receptor 2 (Fgfr2), transcript variant 2, (10ug)
CNY 5320.00
CNY 9310.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AU043015; AW556123; Bek; Fgfr-2; Fgfr-7; Fgfr7; KGFR; KGFRTr; svs |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC221076 representing NM_201601
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-RsrII |
| ACCN | NM_201601 |
| Insert Size | 2181 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_201601.2, NP_963895.2 |
| RefSeq Size | 4881 bp |
| RefSeq ORF | 2181 bp |
| Locus ID | 14183 |
| UniProt ID | P21803 |
| Gene Summary | Tyrosine-protein kinase that acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. Required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. Plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. Promotes cell proliferation in keratinocytes and immature osteoblasts, but promotes apoptosis in differentiated osteoblasts. Phosphorylates PLCG1, FRS2 and PAK4. Ligand binding leads to the activation of several signaling cascades. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate. Phosphorylation of FRS2 triggers recruitment of GRB2, GAB1, PIK3R1 and SOS1, and mediates activation of RAS, MAPK1/ERK2, MAPK3/ERK1 and the MAP kinase signaling pathway, as well as of the AKT1 signaling pathway. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal FGFR2 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1.[UniProtKB/Swiss-Prot Function] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Alveolar cell fate selection and lifelong maintenance of AT2 cells by FGF signaling
,null,
Nature Communications
,PubMed ID 36414616
[Fgfr2]
|
|
Truncated FGFR2 is a clinically actionable oncogene in multiple cancers
,null,
Nature
,PubMed ID 35948633
[Fgfr2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG225121 | Fgfr2 (tGFP-tagged) - Mouse fibroblast growth factor receptor 2 (Fgfr2) transcript variant 2, (10ug) |
CNY 6920.00 |
|
| MR225121 | Fgfr2 (Myc-DDK-tagged) - Mouse fibroblast growth factor receptor 2 (Fgfr2), transcript variant 2 |
CNY 5320.00 |
|
| MR225121L3 | Lenti ORF clone of Fgfr2 (Myc-DDK-tagged) - Mouse fibroblast growth factor receptor 2 (Fgfr2), transcript variant 2 |
CNY 9120.00 |
|
| MR225121L4 | Lenti ORF clone of Fgfr2 (mGFP-tagged) - Mouse fibroblast growth factor receptor 2 (Fgfr2), transcript variant 2 |
CNY 7720.00 |

