Tert (NM_009354) Mouse Untagged Clone
CAT#: MC223645
Tert (untagged) - Mouse telomerase reverse transcriptase (Tert), (10ug)
CNY 11,728.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | EST2; TCS1; TP2; TR; TRT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC223645 representing NM_009354
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009354 |
Insert Size | 3369 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009354.1, NP_033380.1 |
RefSeq Size | 3426 bp |
RefSeq ORF | 3369 bp |
Locus ID | 21752 |
UniProt ID | O70372 |
Gene Summary | Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most eukaryotes. Active in progenitor and cancer cells. Inactive, or very low activity, in normal somatic cells. Catalytic component of the teleromerase holoenzyme complex whose main activity is the elongation of telomeres by acting as a reverse transcriptase that adds simple sequence repeats to chromosome ends by copying a template sequence within the RNA component of the enzyme. Catalyzes the RNA-dependent extension of 3'-chromosomal termini with the 6-nucleotide telomeric repeat unit, 5'-TTAGGG-3'. The catalytic cycle involves primer binding, primer extension and release of product once the template boundary has been reached or nascent product translocation followed by further extension. More active on substrates containing 2 or 3 telomeric repeats. Telomerase activity is regulated by a number of factors including telomerase complex-associated proteins, chaperones and polypeptide modifiers. Modulates Wnt signaling. Plays important roles in aging and antiapoptosis (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226892 | Tert (tGFP-tagged) - Mouse telomerase reverse transcriptase (Tert), (10ug) |
CNY 13,320.00 |
|
MR226892 | Tert (Myc-DDK-tagged) - Mouse telomerase reverse transcriptase (Tert) |
CNY 11,720.00 |
|
MR226892L3 | Lenti ORF clone of Tert (Myc-DDK-tagged) - Mouse telomerase reverse transcriptase (Tert) |
CNY 14,120.00 |
|
MR226892L4 | Lenti ORF clone of Tert (mGFP-tagged) - Mouse telomerase reverse transcriptase (Tert) |
CNY 14,120.00 |