Nrep (NM_001267717) Mouse Untagged Clone
CAT#: MC225501
Nrep (untagged) - Mouse neuronal regeneration related protein (Nrep), transcript variant 5
CNY 2000.00
货期*
3周
规格
Product images
推荐一起购买 (3)
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI325076; D0H4S114; Harp; P311; PTZ17; SEZ17 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC225501 representing NM_001267717
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTTACTACCCAGAACTCTTGGTCTGGGTCAGCCAAGAACCGTTTGCATACAAGGAAATGGAGGGAG GTCTTATTAAGGGAAGACTTCCCGTGCCTAAGGAAGTGAACCGAAAGAAGATGGAGGAGACTGGCGCTGC CTCGCTGACTCCGCCAGGCAGCCGTGAATTCACCTCTCCAGCTACCAGTTACCTCCACCCTTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001267717 |
| Insert Size | 207 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001267717.1, NP_001254646.1 |
| RefSeq Size | 2097 bp |
| RefSeq ORF | 207 bp |
| Locus ID | 27528 |
| UniProt ID | Q07475 |
| Gene Summary | May have roles in cellular differentiation. Ectopic expression induces differentiation of fibroblast into myofibroblast and myofibroblast ameboid migration. Increases retinoic-acid regulation of lipid-droplet biogenesis. May also have neural functions. Promotes axonal regeneration and augments motility of gliomas. Down-regulates the expression of TGFB1 and TGFB2 but not of TGFB3. May play a role in the regulation of alveolar generation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4 and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcripts of different breeds and genomic sequence data because no single transcript from the same breed was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR227712 | Nrep (myc-DDK-tagged) - Mouse neuronal regeneration related protein (Nrep), transcript variant 5 |
CNY 1200.00 |
Customer
Reviews
Loading...
