Olr1 (NM_001301094) Mouse Untagged Clone

CAT#: MC226173

Olr1 (untagged) - Mouse oxidized low density lipoprotein (lectin-like) receptor 1 (Olr1), transcript variant 3



  "NM_001301094" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms LOX-1; Scare1; SR-EI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226173 representing NM_001301094
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTTTTGATGACAAGATGAAGCCTGCGAATGACGAGCCTGATCAGAAGTCATGTGGCAAGAAGCCTA
AAGGTCTGCATTTGCTTTCTTCCCCATGGTGGTTCCCTGCTGCTATGACTCTGGTCATCCTCTGCCTGGT
GTTGTCAGTGACCCTTATTGTACAGTGGACACAATGTCCTTGTCCACAAGACTGGCTCTGGCATAAAGAA
AACTGTTACCTCTTCCATGGGCCCTTTAGCTGGGAAAAAAACCGGCAGACCTGCCAATCTTTGGGTGGCC
AGTTACTACAAATTAATGGTGCAGATGATCTGACATTCATCTTACAAGCAATTTCCCATACCACCTCCCC
GTTCTGGATTGGATTGCATCGGAAGAAGCCTGGCCAACCATGGCTATGGGAGAATGGAACTCCTTTGAAT
TTTCAATTCTTTAAGACCAGGGGCGTTTCTTTACAGCTATATTCATCAGGCAACTGTGCATACCTTCAAG
ACGGAGCTGTGTTCGCTGAAAACTGCATTCTAATTGCATTCAGCATATGTCAGAAGAAGACAAATCATTT
GCAAATTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301094
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301094.1, NP_001288023.1
RefSeq Size 3059 bp
RefSeq ORF 570 bp
Locus ID 108078
Gene Summary Receptor that mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. OxLDL is a marker of atherosclerosis that induces vascular endothelial cell activation and dysfunction, resulting in pro-inflammatory responses, pro-oxidative conditions and apoptosis. Its association with oxLDL induces the activation of NF-kappa-B through an increased production of intracellular reactive oxygen and a variety of pro-atherogenic cellular responses including a reduction of nitric oxide (NO) release, monocyte adhesion and apoptosis. In addition to binding oxLDL, it acts as a receptor for the HSP70 protein involved in antigen cross-presentation to naive T-cells in dendritic cells, thereby participating in cell-mediated antigen cross-presentation. Also involved in inflammatory process, by acting as a leukocyte-adhesion molecule at the vascular interface in endotoxin-induced inflammation. Also acts as a receptor for advanced glycation end (AGE) products, activated platelets, monocytes, apoptotic cells and both Gram-negative and Gram-positive bacteria (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks exons in the coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...