Fgfbp1 (NM_001271616) Mouse Untagged Clone

CAT#: MC226584

Fgfbp1 (untagged) - Mouse fibroblast growth factor binding protein 1 (Fgfbp1), transcript variant 1



  "NM_001271616" in other vectors (1)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms FGF-BP; FGF-BP1; FGFBP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226584 representing NM_001271616
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGACTCCACAGCCTCATCCTGCTCTCCTTCCTTCTCCTGGCTACTCAGGCGTTCTCAGAAAAGGTCA
GAAAGAGAGCCAAGAACGCACCACACAGCACAGCGGAGGAGGGGGTAGAGGGTTCAGCTCCCTCGTTAGG
GAAGGCCCAGAATAAGCAGAGAAGCAGGACATCTAAATCTCTGACGCATGGCAAGTTTGTCACCAAAGAC
CAAGCCACATGCAGATGGGCTGTGACTGAGGAGGAGCAGGGCATCAGCCTGAAGGTCCAGTGCACACAAG
CCGATCAGGAGTTTTCTTGTGTTTTTGCTGGTGACCCAACTGACTGCCTTAAACACGACAAAGACCAGAT
CTACTGGAAACAGGTTGCCCGCACGCTGCGCAAACAGAAAAATATCTGCAGGAACGCCAAGAGTGTCTTG
AAGACCAGAGTGTGCAGAAAGAGATTTCCAGAGTCTAACCTCAAGCTGGTGAACCCCAACGCACGTGGAA
ACACGAAGCCCAGGAAGGAGAAAGCAGAGGTCTCCGCAAGGGAGCACAACAAGGTCCAAGAAGCTGTCTC
CACGGAGCCAAACAGGGTCAAAGAAGACATCACACTCAATCCAGCTGCGACCCAGACCATGGCCATTAGA
GATCCAGAGTGTCTAGAGGATCCAGATGTGCTCAACCAGAGGAAGACCGCCCTGGAGTTCTGTGGGGAAT
CTTGGAGCTCCATTTGCACATTCTTCCTCAACATGTTACAGGCGACATCATGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271616
Insert Size 756 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271616.1, NP_001258545.1
RefSeq Size 1248 bp
RefSeq ORF 756 bp
Locus ID 14181
UniProt ID O70514
Gene Summary Acts as a carrier protein that releases fibroblast-binding factors (FGFs) from the extracellular matrix (EM) storage and thus enhances the mitogenic activity of FGFs. Enhances FGF2 signaling during tissue repair, angiogenesis and in tumor growth (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...