Spn (NM_009259) Mouse Untagged Clone

CAT#: MC227471

Spn (untagged) - Mouse sialophorin (Spn), transcript variant 1



  "NM_009259" in other vectors (1)

CNY 3800.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A630014B01Rik; Cd43; Galgp; Ly-48; Ly48
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227471 representing NM_009259
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCTTGCACCTTCTCCTCCTCTTTGGGGCATGCTGGGTCCAGGTGGCGAGCCCAGACAGTCTGCAGA
GGACGACGATGCTACCATCTACCCCACATATCACAGCTCCAAGTACCTCTGAAGCCCAGAATGCCAGCCC
ATCAGTTTCTGTGGGGTCAGGGACAGTGGACTCGAAGGAGACCATCAGCCCCTGGGGGCAGACCACAATC
CCAGTTTCTTTGACCCCCTTGGAAACTACTGAATTGTCTTCTTTGGAGACTTCTGCTGGTGCCAGCATGA
GCACCCCTGTACCTGAGCCTACTGCCTCTCAGGAAGTTTCCAGCAAGACATCAGCACTGCTTCCAGAACC
ATCAAATGTAGCCAGTGACCCTCCTGTCACTGCAGCCAATCCTGTGACAGACGGACCTGCAGCCAATCCT
GTGACAGACGGAACTGCAGCATCTACATCTATCTCTAAAGGAACCAGTGCACCCCCCACCACTGTGACAA
CAAGCTCTAACGAGACCAGTGGACCCTCTGTGGCTACAACAGTAAGCTCCAAGACCAGTGGTCCCCCTGT
CACCACAGCTACTGGGTCTCTGGGGCCCTCGAGTGAGATGCATGGACTCCCTGCTACCACAGCAACCAGT
TCTGTGGAGAGTTCCAGTGTGGCCCGTGGCACCTCAGTTTCCAGCAGAAAAACATCCACGACGTCTACCC
AAGATCCCATAACCACCAGGTCACCAAGCCAAGAATCAAGTGGCATGTTACTGGTGCCCATGCTTATTGC
CTTGGTGGTGGTTTTGGCCCTCGTGGCGCTACTGCTGTTGTGGCGCCAGAGGCAAAAGCGGAGGACTGGG
GCCCTGACCCTGAGCGGAGGAGGAAAACGAAATGGGGTGGTGGATGCCTGGGCTGGGCCAGCCCGGGTTC
CTGATGAAGAGGCCACAACCACATCAGGGGCAGGGGGCAACAAGGGCTCTGAGGTACTGGAGACAGAAGG
CTCCGGGCAGAGACCCACGCTCACTACGTTCTTCAGCAGACGGAAGTCTCGCCAGGGCTCTTTAGTACTA
GAAGAGCTGAAGCCTGGGTCGGGTCCCAACCTGAAGGGGGAGGAAGAGCCGCTTGTGGGCAGTGAGGATG
AAGCTGTGGAAACCCCAACTTCTGACGGTCCACAAGCCAAAGATGAGGCCGCACCTCAATCTCTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009259
Insert Size 1188 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009259.5, NP_033285.1
RefSeq Size 3751 bp
RefSeq ORF 1188 bp
Locus ID 20737
UniProt ID P15702
Gene Summary Predominant cell surface sialoprotein of leukocytes which regulates multiple T-cell functions, including T-cell activation, proliferation, differentiation, trafficking and migration. Positively regulates T-cell trafficking to lymph-nodes via its association with ERM proteins (EZR, RDX and MSN) (PubMed:17638845, PubMed:21289089, PubMed:11728336). Negatively regulates Th2 cell differentiation and predisposes the differentiation of T-cells towards a Th1 lineage commitment (PubMed:18490738). Promotes the expression of IFN-gamma by T-cells during T-cell receptor (TCR) activation of naive cells and induces the expression of IFN-gamma by CD4(+) T-cells and to a lesser extent by CD8(+) T-cells. Plays a role in preparing T-cells for cytokine sensing and differentiation into effector cells by inducing the expression of cytokine receptors IFNGR and IL4R, promoting IFNGR and IL4R signaling and by mediating the clustering of IFNGR with TCR (By similarity). Acts as a major E-selectin ligand responsible for Th17 cell rolling on activated vasculature and recruitment during inflammation. Mediates Th17 cells, but not Th1 cells, adhesion to E-selectin (PubMed:26700769). Acts as a T-cell counter-receptor for SIGLEC1 (PubMed:11238599).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...