Ddx39b (NM_001252457) Mouse Untagged Clone

CAT#: MC227645

Ddx39b (untagged) - Mouse DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (Ddx39b), transcript variant 2



  "NM_001252457" in other vectors (1)

CNY 4090.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610030D10Rik; AI428441; Bat-1; Bat1; Bat1a; D6S81Eh; D17H6S81E; D17H6S81E-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227645 representing NM_001252457
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAGAACGATGTGGACAATGAGCTCTTGGACTACGAAGACGACGAGGTGGAGACAGCCGCTGGGG
CAGATGGGACCGAGGCTCCCGCCAAGAAAGACGTCAAGGGCTCCTACGTCTCCATCCACAGCTCCGGCTT
CCGAGATTTTCTACTCAAGCCAGAGCTGCTCCGGGCCATCGTTGACTGTGGCTTTGAGCATCCATCAGAG
GTCCAGCATGAGTGCATCCCGCAGGCCATTCTGGGGATGGATGTCCTGTGCCAGGCCAAGTCAGGCATGG
GAAAAACAGCAGTGTTTGTCCTGGCCACACTGCAGCAGCTGGAGCCCGTTACTGGGCAGGTGTCTGTGCT
GGTGATGTGTCACACTAGGGAGCTGGCTTTTCAGATCAGCAAGGAATATGAGCGCTTCTCTAAGTACATG
CCGAATGTCAAGGTGGCAGTGTTTTTTGGCGGTCTGTCTATCAAGAAGGACGAAGAGGTGCTGAAGAAGA
ACTGCCCACACATCGTCGTGGGGACTCCTGGCCGAATTCTAGCCCTGGCTCGAAATAAGAGCCTGAACCT
CAAACACATTAAACACTTTATTTTGGACGAGTGTGACAAGATGCTTGAACAGCTCGACATGCGTCGGGAT
GTCCAGGAAATTTTTCGCATGACCCCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAG
AGATCCGCCCAGTCTGCCGCAAGTTCATGCAAGATCCTATGGAGATCTTCGTGGATGACGAGACCAAGTT
GACGCTGCACGGGTTGCAGCAGTACTACGTGAAACTGAAGGACAACGAGAAGAACCGGAAGCTCTTTGAT
CTTCTCGATGTCCTCGAGTTCAACCAGGTGGTGATCTTTGTGAAGTCCGTGCAGCGCTGCATCGCCCTGG
CCCAGCTTCTAGTGGAACAGAACTTCCCAGCCATTGCTATCCATCGTGGAATGCCCCAGGAGGAGAGGCT
CTCTCGGTATCAGCAGTTCAAGGATTTTCAGCGGAGGATTCTTGTGGCTACCAACCTGTTTGGCCGAGGC
ATGGATATTGAGCGTGTGAACATTGCTTTCAACTATGACATGCCAGAGGACTCGGACACCTACCTGCACA
GGGTGGCCAGAGCGGGCCGGTTTGGCACCAAGGGCTTGGCCATCACATTTGTGTCAGATGAGAATGATGC
CAAGATCCTGAATGACGTTCAGGACCGTTTCGAGGTCAACATCAGCGAGCTGCCCGATGAGATTGACATT
TCCTCCTACATTGAGCAGACACGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252457
Insert Size 1287 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252457.1, NP_001239386.1
RefSeq Size 1651 bp
RefSeq ORF 1287 bp
Locus ID 53817
UniProt ID Q9Z1N5
Gene Summary Involved in nuclear export of spliced and unspliced mRNA. Assembling component of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NFX1 pathway. May undergo several rounds of ATP hydrolysis during assembly of TREX to drive subsequent loading of components such as ALYREF/THOC and CHTOP onto mRNA. Also associates with pre-mRNA independent of ALYREF/THOC4 and the THO complex. Involved in the nuclear export of intronless mRNA; the ATP-bound form is proposed to recruit export adapter ALYREF/THOC4 to intronless mRNA; its ATPase activity is cooperatively stimulated by RNA and ALYREF/THOC4 and ATP hydrolysis is thought to trigger the dissociation from RNA to allow the association of ALYREF/THOC4 and the NXF1-NXT1 heterodimer. Involved in transcription elongation and genome stability (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...