Pf4 (NM_019932.4) Mouse Untagged Clone
CAT#: MC229777
Pf4 (untagged) - Mouse platelet factor 4 (Pf4), (10ug)
CNY 1200.00
CNY 2300.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Cxcl4; Scyb4 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC229777 representing .
Blue=ORF Red=Cloning site Green=Tag(s) ATGAGCGTCGCTGCGGTGTTTCGAGGCCTCCGGCCCAGTCCTGAGCTGCTGCTTCTGGGCCTGTTGTTT CTGCCAGCGGTGGTTGCTGTCACCAGCGCTGGTCCCGAAGAAAGCGATGGAGATCTTAGCTGTGTGTGT GTGAAGACCATCTCCTCTGGGATCCATCTTAAGCACATCACCAGCCTGGAGGTGATCAAGGCAGGACGC CACTGTGCGGTTCCCCAGCTCATAGCCACCCTGAAGAATGGGAGGAAAATTTGCCTGGACCGGCAAGCA CCCCTATATAAGAAAGTAATCAAGAAAATCCTGGAGAGTTAG |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_019932.4 |
| Insert Size | 318 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019932.4 |
| RefSeq Size | 615 bp |
| RefSeq ORF | 318 bp |
| Locus ID | 56744 |
| UniProt ID | Q9Z126 |
| MW | 11.2 kDa |
| Gene Summary | Released during platelet aggregation. Neutralizes the anticoagulant effect of heparin because it binds more strongly to heparin than to the chondroitin-4-sulfate chains of the carrier molecule. Chemotactic for neutrophils and monocytes. Inhibits endothelial cell proliferation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MC204985 | Pf4 (untagged) - Mouse platelet factor 4 (Pf4), (10ug) |
CNY 1200.00 |
|
| MG200359 | Pf4 (tGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 4 (Cxcl4) |
CNY 2850.00 |
|
| MR200359 | Pf4 (Myc-DDK-tagged) - Mouse platelet factor 4 (Pf4) |
CNY 1200.00 |
|
| MR200359L3 | Lenti ORF clone of Pf4 (Myc-DDK-tagged) - Mouse platelet factor 4 (Pf4) |
CNY 4750.00 |
|
| MR200359L4 | Lenti ORF clone of Pf4 (mGFP-tagged) - Mouse platelet factor 4 (Pf4) |
CNY 4750.00 |
