Pold4 (NM_027196) Mouse Tagged ORF Clone
CAT#: MR200389
- TrueORF®
Pold4 (Myc-DDK-tagged) - Mouse polymerase (DNA-directed), delta 4 (Pold4)
ORF Plasmid: tGFP
"NM_027196" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 1200.00
CNY 3705.00
CNY 300.00
CNY 6840.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | 2410012M21Rik; AI463381; AW060307; p12; Polds |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR200389 representing NM_027196
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTCGGAAGCGGTTCATCACTGACTCCTATCCTGTTGTGAAGAAGAGGGAGGGGCCCCCTGGGCACA GCAAGGGAGAGCTGGCACCCGAGCTAGGGGAAGACACCCAGTCCCTCAGCCAGGAGGAAACAGAGCTGGA GCTGCTGAGGCAGTTTGACCTGGCCTGGCAGTATGGGCCTTGTACAGGTATCACAAGGCTGCAGCGCTGG AGTCGGGCAGAGCAGATGGGCTTGAAGCCCCCCCTAGAGGTGTACCAAGTGTTGAAGGCACACCCTGAAG ACCCTCACTTCCAATGCAGCCTGTGGCATCTCTACCCACTC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene |
ACCN | NM_027196 |
ORF Size | 321 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_027196.4 |
RefSeq Size | 933 bp |
RefSeq ORF | 324 bp |
Locus ID | 69745 |
UniProt ID | Q9CWP8 |
MW | 12.9 kDa |
Gene Summary | As a component of the tetrameric DNA polymerase delta complex (Pol-delta4), plays a role in high fidelity genome replication and repair. Within this complex, increases the rate of DNA synthesis and decreases fidelity by regulating POLD1 polymerase and proofreading 3' to 5' exonuclease activity. Pol-delta4 participates in Okazaki fragment processing, through both the short flap pathway, as well as a nick translation system. Under conditions of DNA replication stress, required for the repair of broken replication forks through break-induced replication (BIR), a mechanism that may induce segmental genomic duplications of up to 200 kb. Involved in Pol-delta4 translesion synthesis (TLS) of templates carrying O6-methylguanine or abasic sites. Its degradation in response to DNA damage is required for the inhibition of fork progression and cell survival.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC201373 | Pold4 (untagged) - Mouse polymerase (DNA-directed), delta 4 (Pold4), (10ug) |
CNY 1200.00 |
|
MG200389 | Pold4 (tGFP-tagged) - Mouse polymerase (DNA-directed), delta 4 (Pold4) |
CNY 2850.00 |
|
MR200389L3 | Lenti ORF clone of Pold4 (Myc-DDK-tagged) - Mouse polymerase (DNA-directed), delta 4 (Pold4) |
CNY 4750.00 |
|
MR200389L4 | Lenti ORF clone of Pold4 (mGFP-tagged) - Mouse polymerase (DNA-directed), delta 4 (Pold4) |
CNY 4750.00 |