Atg3 (NM_026402) Mouse Tagged ORF Clone

CAT#: MR204475

  • TrueORF®

Atg3 (Myc-DDK-tagged) - Mouse autophagy-related 3 (yeast) (Atg3)

ORF Plasmid: DDK tGFP



  "NM_026402" in other vectors (4)

Need custom modification / cloning service?
Get a free quote

Mouse Protein / Lysate Request

CNY 1,416.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag, 10ug
    • 10 ug

CNY 5,420.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
    • 30 ul

CNY 300.00

Specifications

Product Data
Type Mouse Tagged ORF Clone
Tag Myc-DDK
Synonyms 2610016C12Rik; APG3; Apg3l; Atg3l; PC3-96
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MR204475 representing NM_026402
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGAATGTGATCAACACGGTGAAGGGAAAGGCTCTGGAAGTGGCCGAGTACCTGACCCCGGTCCTCA
AGGAATCAAAATTTAAGGAAACGGGTGTAATCACTCCAGAAGAGTTTGTGGCAGCTGGAGATCACTTAGT
CCACCACTGTCCAACATGGCAATGGGCTACAGGGGAAGAATTGAAAGTGAAGGCATATCTTCCGACAGAC
AAACAATTTTTGGTAACCAAAAATGTTCCATGCTACAAGCGGTGTAAACAGATGGAGTATTCGGATGAAT
TGGAAGCTATCATTGAAGAAGATGATGGTGATGGGGGATGGGTAGATACATATCACAACACAGGTATTAC
AGGAATTACTGAAGCAGTTAAGGAGATTACACTGGAAAGCAAGGACAGTATAAAACTCCAAGATTGCTCA
GCACTGTGTGATGAAGAAGACGAGGAAGATGAAGGGGAAGCTGCAGACATGGAAGAATATGAAGAGAGTG
GATTGTTGGAAACAGATGAGGCTACCCTAGACACAAGGAAAATAGTGGAAGCCTGCAAAGCTAAGGCTGA
CGCTGGAGGTGAAGATGCTATTTTACAAACGAGAACATACGATCTGTACATCACTTACGACAAATATTAC
CAGACACCACGGCTATGGTTGTTTGGCTATGATGAGCAACGGCAGCCTTTAACAGTTGAGCACATGTATG
AAGACATCAGTCAAGATCATGTGAAGAAAACAGTGACCATTGAAAACCATCCTCATCTCCCACCACCTCC
TATGTGTTCAGTTCACCCATGCAGGCATGCTGAAGTGATGAAGAAAATTATTGAGACAGTTGCAGAAGGC
GGGGGAGAGCTTGGTGTTCATATGTATCTTTTAATTTTTTTGAAATTTGTTCAAGCTGTCATTCCAACAA
TAGAATATGACTACACAAGACACTTCACAATG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI      Cloning Scheme for this gene      Plasmid Map     
ACCN NM_026402
ORF Size 942 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_026402.1, NM_026402.2, NM_026402.3, NP_080678.1
RefSeq Size 2014 bp
RefSeq ORF 945 bp
Locus ID 67841
UniProt ID Q9CPX6
MW 36.2 kDa
Gene Summary E2 conjugating enzyme required for the cytoplasm to vacuole transport (Cvt), autophagy, and mitochondrial homeostasis. Responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8-like proteins (GABARAP, GABARAPL1, GABARAPL2 or MAP1LC3A). The ATG12-ATG5 conjugate plays a role of an E3 and promotes the transfer of ATG8-like proteins from ATG3 to phosphatidylethanolamine (PE). This step is required for the membrane association of ATG8-like proteins. The formation of the ATG8-phosphatidylethanolamine conjugates is essential for autophagy and for the cytoplasm to vacuole transport (Cvt). Preferred substrate is MAP1LC3A. Also acts as an autocatalytic E2-like enzyme, catalyzing the conjugation of ATG12 to itself, ATG12 conjugation to ATG3 playing a role in mitochondrial homeostasis but not in autophagy. ATG7 (E1-like enzyme) facilitates this reaction by forming an E1-E2 complex with ATG3. ATG12-ATG3 conjugate is also formed upon viccina virus infection, leading to the disruption the cellular autophagy which is not necessary for vaccinia survival and proliferation. Promotes primary ciliogenesis by removing OFD1 from centriolar satellites via the autophagic pathway.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...