Atg3 (NM_026402) Mouse Tagged ORF Clone
CAT#: MR204475
- TrueORF®
Atg3 (Myc-DDK-tagged) - Mouse autophagy-related 3 (yeast) (Atg3)
ORF Plasmid: tGFP
"NM_026402" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 1,416.00
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | 2610016C12Rik; APG3; Apg3l; Atg3l; PC3-96 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR204475 representing NM_026402
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGAATGTGATCAACACGGTGAAGGGAAAGGCTCTGGAAGTGGCCGAGTACCTGACCCCGGTCCTCA AGGAATCAAAATTTAAGGAAACGGGTGTAATCACTCCAGAAGAGTTTGTGGCAGCTGGAGATCACTTAGT CCACCACTGTCCAACATGGCAATGGGCTACAGGGGAAGAATTGAAAGTGAAGGCATATCTTCCGACAGAC AAACAATTTTTGGTAACCAAAAATGTTCCATGCTACAAGCGGTGTAAACAGATGGAGTATTCGGATGAAT TGGAAGCTATCATTGAAGAAGATGATGGTGATGGGGGATGGGTAGATACATATCACAACACAGGTATTAC AGGAATTACTGAAGCAGTTAAGGAGATTACACTGGAAAGCAAGGACAGTATAAAACTCCAAGATTGCTCA GCACTGTGTGATGAAGAAGACGAGGAAGATGAAGGGGAAGCTGCAGACATGGAAGAATATGAAGAGAGTG GATTGTTGGAAACAGATGAGGCTACCCTAGACACAAGGAAAATAGTGGAAGCCTGCAAAGCTAAGGCTGA CGCTGGAGGTGAAGATGCTATTTTACAAACGAGAACATACGATCTGTACATCACTTACGACAAATATTAC CAGACACCACGGCTATGGTTGTTTGGCTATGATGAGCAACGGCAGCCTTTAACAGTTGAGCACATGTATG AAGACATCAGTCAAGATCATGTGAAGAAAACAGTGACCATTGAAAACCATCCTCATCTCCCACCACCTCC TATGTGTTCAGTTCACCCATGCAGGCATGCTGAAGTGATGAAGAAAATTATTGAGACAGTTGCAGAAGGC GGGGGAGAGCTTGGTGTTCATATGTATCTTTTAATTTTTTTGAAATTTGTTCAAGCTGTCATTCCAACAA TAGAATATGACTACACAAGACACTTCACAATG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_026402 |
ORF Size | 942 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_026402.1, NM_026402.2, NM_026402.3, NP_080678.1 |
RefSeq Size | 2014 bp |
RefSeq ORF | 945 bp |
Locus ID | 67841 |
UniProt ID | Q9CPX6 |
MW | 36.2 kDa |
Gene Summary | E2 conjugating enzyme required for the cytoplasm to vacuole transport (Cvt), autophagy, and mitochondrial homeostasis. Responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8-like proteins (GABARAP, GABARAPL1, GABARAPL2 or MAP1LC3A). The ATG12-ATG5 conjugate plays a role of an E3 and promotes the transfer of ATG8-like proteins from ATG3 to phosphatidylethanolamine (PE). This step is required for the membrane association of ATG8-like proteins. The formation of the ATG8-phosphatidylethanolamine conjugates is essential for autophagy and for the cytoplasm to vacuole transport (Cvt). Preferred substrate is MAP1LC3A. Also acts as an autocatalytic E2-like enzyme, catalyzing the conjugation of ATG12 to itself, ATG12 conjugation to ATG3 playing a role in mitochondrial homeostasis but not in autophagy. ATG7 (E1-like enzyme) facilitates this reaction by forming an E1-E2 complex with ATG3. ATG12-ATG3 conjugate is also formed upon viccina virus infection, leading to the disruption the cellular autophagy which is not necessary for vaccinia survival and proliferation. Promotes primary ciliogenesis by removing OFD1 from centriolar satellites via the autophagic pathway.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC201069 | Atg3 (untagged) - Mouse autophagy-related 3 (yeast) (Atg3), (10ug) |
CNY 2,000.00 |
|
MG204475 | Atg3 (tGFP-tagged) - Mouse autophagy-related 3 (yeast) (Atg3) |
CNY 2,850.00 |
|
MR204475L3 | Lenti ORF clone of Atg3 (Myc-DDK-tagged) - Mouse autophagy-related 3 (yeast) (Atg3) |
CNY 4,750.00 |
|
MR204475L4 | Lenti ORF clone of Atg3 (mGFP-tagged) - Mouse autophagy-related 3 (yeast) (Atg3) |
CNY 4,750.00 |