Irf7 (NM_016850) Mouse Tagged ORF Clone
CAT#: MR225814
- TrueORF®
Irf7 (Myc-DDK-tagged) - Mouse interferon regulatory factor 7 (Irf7)
ORF Plasmid: tGFP
"NM_016850" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 3,330.00
Cited in 1 publication. |
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR225814 representing NM_016850
Red=Cloning site Blue=ORF Green=Tags(s) CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGAAGTGAGGGGGGTCCAGCGAGTGCTGTTTGGAGACTGGCTATTGGGGGAGGTCAGCAGCGGCC AGTACGAGGGGCTGCAGTGGCTGAACGAGGCTCGCACAGTCTTCCGCGTACCCTGGAAGCATTTCGGTCG TAGGGATCTGGATGAAGAAGATGCACAGATCTTCAAGGCCTGGGCTGTGGCCCGAGGGAGGTGGCCACCT AGTGGAGTTAACCTGCCACCCCCAGAGGCTGAGGCTGCTGAGCGAAGAGAGCGAAGAGGCTGGAAGACCA ACTTCCGCTGTGCACTCCACAGCACAGGGCGTTTTATCTTGCGCCAAGACAATTCAGGGGATCCAGTTGA TCCGCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAATAGGGAA GAAGTGAGCCTCAGCAATGCTCTGCCCACACAGGGTGTGTCCCCAGGATCATTTCTGGCAAGAGAAAATG CTGGGCTCCAAACCCCAAGCCCTCTGCTTTCTAGTGATGCCGGGGACCTCTTGCTTCAGGTTCTGCAGTA CAGCCACATACTGGAATCCGAGTCTGGGGCAGACCCCGTCCCACCACAGGCTCCTGGCCAGGAGCAAGAC CGTGTTTACGAGGAACCCTATGCAGCATGGCAGGTGGAAGCTGTCCCCAGTCCCAGGCCTCAACAGCCAG CTCTCACCGAGCGCAGCCTTGGGTTCCTGGATGTGACCATCATGTACAAGGGCCGCACAGTGCTACAGGC AGTGGTGGGGCACCCCAGATGCGTGTTCCTGTACAGCCCCATGGCCCCAGCAGTAAGAACTTCAGAGCCC CAGCCGGTGATCTTTCCCAGTCCTGCTGAGCTCCCAGATCAGAAGCAGCTGCACTACACAGAGACGCTTC TCCAGCATGTGTCTCCCGGCCTTCAGCTGGAGCTTCGAGGACCGTCACTGTGGGCCCTGCGTATGGGCAA GTGCAAGGTGTACTGGGAGGTAGGCAGCCCTATGGGCACTACCGGCCCCTCCACCCCACCCCAGCTGCTG GAGCGCAACCGCCACACCCCCATCTTCGACTTCAGCACTTTCTTCCGAGAACTGGAGGAGTTTCGGGCTC GGAGGCGGCAAGGGTCACCACACTACACCATCTACCTGGGTTTTGGGCAAGACTTGTCAGCAGGGAGGCC CAAGGAGAAGACCCTGATCCTGGTGAAGCTGGAGCCATGGGTATGCAAGGCATACCTGGAGGGCGTGCAG CGTGAGGGTGTGTCCTCCCTGGACAGCAGCAGTCTCGGCTTGTGCTTGTCTAGCACCAACAGTCTCTACG AAGACATCGAACACTTCCTCATGGACCTGGGTCAGTGGCCT ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_016850 |
ORF Size | 1371 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016850.3, NP_058546.1 |
RefSeq Size | 1830 bp |
RefSeq ORF | 1374 bp |
Locus ID | 54123 |
UniProt ID | P70434 |
MW | 51.7 kDa |
Gene Summary | Key transcriptional regulator of type I interferon (IFN)-dependent immune responses and plays a critical role in the innate immune response against DNA and RNA viruses (PubMed:27129230). Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters. Can efficiently activate both the IFN-beta (IFNB) and the IFN-alpha (IFNA) genes and mediate their induction via both the virus-activated, MyD88-independent pathway and the TLR-activated, MyD88-dependent pathway. Induces transcription of ubiquitin hydrolase USP25 mRNA in response to lipopolysaccharide (LPS) or viral infection in a type I IFN-dependent manner (PubMed:27129230). Required during both the early and late phases of the IFN gene induction but is more critical for the late than for the early phase. Exists in an inactive form in the cytoplasm of uninfected cells and following viral infection, double-stranded RNA (dsRNA), or toll-like receptor (TLR) signaling, becomes phosphorylated by IKBKE and TBK1 kinases. This induces a conformational change, leading to its dimerization and nuclear localization where along with other coactivators it can activate transcription of the type I IFN and ISG genes. Can also play a role in regulating adaptive immune responses by inducing PSMB9/LMP2 expression, either directly or through induction of IRF1. Binds to the Q promoter (Qp) of EBV nuclear antigen 1 a (EBNA1) and may play a role in the regulation of EBV latency. Can activate distinct gene expression programs in macrophages and regulate the anti-tumor properties of primary macrophages.[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Myeloid neddylation targets IRF7 and promotes host innate immunity against RNA viruses
,null,
PLoS Pathogens
,PubMed ID 34506605
[Irf7]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC216147 | Irf7 (untagged) - Mouse interferon regulatory factor 7 (Irf7), (10ug) |
CNY 5,990.00 |
|
MG225814 | Irf7 (tGFP-tagged) - Mouse interferon regulatory factor 7 (Irf7), (10ug) |
CNY 3,710.00 |
|
MR225814L3 | Lenti ORF clone of Irf7 (Myc-DDK-tagged) - Mouse interferon regulatory factor 7 (Irf7) |
CNY 5,230.00 |
|
MR225814L4 | Lenti ORF clone of Irf7 (mGFP-tagged) - Mouse interferon regulatory factor 7 (Irf7) |
CNY 5,230.00 |