Irf7 (NM_016850) Mouse Tagged ORF Clone

CAT#: MR225814

  • TrueORF®

Irf7 (Myc-DDK-tagged) - Mouse interferon regulatory factor 7 (Irf7)

ORF Plasmid: DDK tGFP



  "NM_016850" in other vectors (4)

Need custom modification / cloning service?
Get a free quote

Mouse Protein / Lysate Request

CNY 3,330.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag, 10ug
    • 10 ug

CNY 5,420.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
    • 30 ul

CNY 300.00

Specifications

Product Data
Type Mouse Tagged ORF Clone
Tag Myc-DDK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MR225814 representing NM_016850
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAAGTGAGGGGGGTCCAGCGAGTGCTGTTTGGAGACTGGCTATTGGGGGAGGTCAGCAGCGGCC
AGTACGAGGGGCTGCAGTGGCTGAACGAGGCTCGCACAGTCTTCCGCGTACCCTGGAAGCATTTCGGTCG
TAGGGATCTGGATGAAGAAGATGCACAGATCTTCAAGGCCTGGGCTGTGGCCCGAGGGAGGTGGCCACCT
AGTGGAGTTAACCTGCCACCCCCAGAGGCTGAGGCTGCTGAGCGAAGAGAGCGAAGAGGCTGGAAGACCA
ACTTCCGCTGTGCACTCCACAGCACAGGGCGTTTTATCTTGCGCCAAGACAATTCAGGGGATCCAGTTGA
TCCGCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAATAGGGAA
GAAGTGAGCCTCAGCAATGCTCTGCCCACACAGGGTGTGTCCCCAGGATCATTTCTGGCAAGAGAAAATG
CTGGGCTCCAAACCCCAAGCCCTCTGCTTTCTAGTGATGCCGGGGACCTCTTGCTTCAGGTTCTGCAGTA
CAGCCACATACTGGAATCCGAGTCTGGGGCAGACCCCGTCCCACCACAGGCTCCTGGCCAGGAGCAAGAC
CGTGTTTACGAGGAACCCTATGCAGCATGGCAGGTGGAAGCTGTCCCCAGTCCCAGGCCTCAACAGCCAG
CTCTCACCGAGCGCAGCCTTGGGTTCCTGGATGTGACCATCATGTACAAGGGCCGCACAGTGCTACAGGC
AGTGGTGGGGCACCCCAGATGCGTGTTCCTGTACAGCCCCATGGCCCCAGCAGTAAGAACTTCAGAGCCC
CAGCCGGTGATCTTTCCCAGTCCTGCTGAGCTCCCAGATCAGAAGCAGCTGCACTACACAGAGACGCTTC
TCCAGCATGTGTCTCCCGGCCTTCAGCTGGAGCTTCGAGGACCGTCACTGTGGGCCCTGCGTATGGGCAA
GTGCAAGGTGTACTGGGAGGTAGGCAGCCCTATGGGCACTACCGGCCCCTCCACCCCACCCCAGCTGCTG
GAGCGCAACCGCCACACCCCCATCTTCGACTTCAGCACTTTCTTCCGAGAACTGGAGGAGTTTCGGGCTC
GGAGGCGGCAAGGGTCACCACACTACACCATCTACCTGGGTTTTGGGCAAGACTTGTCAGCAGGGAGGCC
CAAGGAGAAGACCCTGATCCTGGTGAAGCTGGAGCCATGGGTATGCAAGGCATACCTGGAGGGCGTGCAG
CGTGAGGGTGTGTCCTCCCTGGACAGCAGCAGTCTCGGCTTGTGCTTGTCTAGCACCAACAGTCTCTACG
AAGACATCGAACACTTCCTCATGGACCTGGGTCAGTGGCCT


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI      Cloning Scheme for this gene      Plasmid Map     
ACCN NM_016850
ORF Size 1371 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016850.3, NP_058546.1
RefSeq Size 1830 bp
RefSeq ORF 1374 bp
Locus ID 54123
UniProt ID P70434
MW 51.7 kDa
Gene Summary Key transcriptional regulator of type I interferon (IFN)-dependent immune responses and plays a critical role in the innate immune response against DNA and RNA viruses (PubMed:27129230). Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters. Can efficiently activate both the IFN-beta (IFNB) and the IFN-alpha (IFNA) genes and mediate their induction via both the virus-activated, MyD88-independent pathway and the TLR-activated, MyD88-dependent pathway. Induces transcription of ubiquitin hydrolase USP25 mRNA in response to lipopolysaccharide (LPS) or viral infection in a type I IFN-dependent manner (PubMed:27129230). Required during both the early and late phases of the IFN gene induction but is more critical for the late than for the early phase. Exists in an inactive form in the cytoplasm of uninfected cells and following viral infection, double-stranded RNA (dsRNA), or toll-like receptor (TLR) signaling, becomes phosphorylated by IKBKE and TBK1 kinases. This induces a conformational change, leading to its dimerization and nuclear localization where along with other coactivators it can activate transcription of the type I IFN and ISG genes. Can also play a role in regulating adaptive immune responses by inducing PSMB9/LMP2 expression, either directly or through induction of IRF1. Binds to the Q promoter (Qp) of EBV nuclear antigen 1 a (EBNA1) and may play a role in the regulation of EBV latency. Can activate distinct gene expression programs in macrophages and regulate the anti-tumor properties of primary macrophages.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...