Irf7 (NM_016850) Mouse Untagged Clone

CAT#: MC216147

Irf7 (untagged) - Mouse interferon regulatory factor 7 (Irf7), (10ug)



  "NM_016850" in other vectors (4)

CNY 5990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216147 representing NM_016850
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAAGTGAGGGGGGTCCAGCGAGTGCTGTTTGGAGACTGGCTATTGGGGGAGGTCAGCAGCGGCC
AGTACGAGGGGCTGCAGTGGCTGAACGAGGCTCGCACAGTCTTCCGCGTACCCTGGAAGCATTTCGGTCG
TAGGGATCTGGATGAAGAAGATGCACAGATCTTCAAGGCCTGGGCTGTGGCCCGAGGGAGGTGGCCACCT
AGTGGAGTTAACCTGCCACCCCCAGAGGCTGAGGCTGCTGAGCGAAGAGAGCGAAGAGGCTGGAAGACCA
ACTTCCGCTGTGCACTCCACAGCACAGGGCGTTTTATCTTGCGCCAAGACAATTCAGGGGATCCAGTTGA
TCCGCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAATAGGGAA
GAAGTGAGCCTCAGCAATGCTCTGCCCACACAGGGTGTGTCCCCAGGATCATTTCTGGCAAGAGAAAATG
CTGGGCTCCAAACCCCAAGCCCTCTGCTTTCTAGTGATGCCGGGGACCTCTTGCTTCAGGTTCTGCAGTA
CAGCCACATACTGGAATCCGAGTCTGGGGCAGACCCCGTCCCACCACAGGCTCCTGGCCAGGAGCAAGAC
CGTGTTTACGAGGAACCCTATGCAGCATGGCAGGTGGAAGCTGTCCCCAGTCCCAGGCCTCAACAGCCAG
CTCTCACCGAGCGCAGCCTTGGGTTCCTGGATGTGACCATCATGTACAAGGGCCGCACAGTGCTACAGGC
AGTGGTGGGGCACCCCAGATGCGTGTTCCTGTACAGCCCCATGGCCCCAGCAGTAAGAACTTCAGAGCCC
CAGCCGGTGATCTTTCCCAGTCCTGCTGAGCTCCCAGATCAGAAGCAGCTGCACTACACAGAGACGCTTC
TCCAGCATGTGTCTCCCGGCCTTCAGCTGGAGCTTCGAGGACCGTCACTGTGGGCCCTGCGTATGGGCAA
GTGCAAGGTGTACTGGGAGGTAGGCAGCCCTATGGGCACTACCGGCCCCTCCACCCCACCCCAGCTGCTG
GAGCGCAACCGCCACACCCCCATCTTCGACTTCAGCACTTTCTTCCGAGAACTGGAGGAGTTTCGGGCTC
GGAGGCGGCAAGGGTCACCACACTACACCATCTACCTGGGTTTTGGGCAAGACTTGTCAGCAGGGAGGCC
CAAGGAGAAGACCCTGATCCTGGTGAAGCTGGAGCCATGGGTATGCAAGGCATACCTGGAGGGCGTGCAG
CGTGAGGGTGTGTCCTCCCTGGACAGCAGCAGTCTCGGCTTGTGCTTGTCTAGCACCAACAGTCTCTACG
AAGACATCGAACACTTCCTCATGGACCTGGGTCAGTGGCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_016850
Insert Size 1374 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016850.3, NP_058546.1
RefSeq Size 1876 bp
RefSeq ORF 1374 bp
Locus ID 54123
UniProt ID P70434
Gene Summary Key transcriptional regulator of type I interferon (IFN)-dependent immune responses and plays a critical role in the innate immune response against DNA and RNA viruses (PubMed:27129230). Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters. Can efficiently activate both the IFN-beta (IFNB) and the IFN-alpha (IFNA) genes and mediate their induction via both the virus-activated, MyD88-independent pathway and the TLR-activated, MyD88-dependent pathway. Induces transcription of ubiquitin hydrolase USP25 mRNA in response to lipopolysaccharide (LPS) or viral infection in a type I IFN-dependent manner (PubMed:27129230). Required during both the early and late phases of the IFN gene induction but is more critical for the late than for the early phase. Exists in an inactive form in the cytoplasm of uninfected cells and following viral infection, double-stranded RNA (dsRNA), or toll-like receptor (TLR) signaling, becomes phosphorylated by IKBKE and TBK1 kinases. This induces a conformational change, leading to its dimerization and nuclear localization where along with other coactivators it can activate transcription of the type I IFN and ISG genes. Can also play a role in regulating adaptive immune responses by inducing PSMB9/LMP2 expression, either directly or through induction of IRF1. Binds to the Q promoter (Qp) of EBV nuclear antigen 1 a (EBNA1) and may play a role in the regulation of EBV latency. Can activate distinct gene expression programs in macrophages and regulate the anti-tumor properties of primary macrophages.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and it encodes the longest protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...