Aqp4 (NM_012825) Rat Untagged Clone
CAT＃: RN200435
Aqp4 (untagged ORF) - Rat aquaporin 4 (Aqp4), (10 ug)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | AQP-4; Miwc; WCH4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN200435 representing NM_012825
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTGACGGAGCTGCAGCGAGGCGGTGGGGTAAGTGTGGACCTCCCTGCAGCAGAGAGAGCATCATGG TGGCTTTCAAAGGCGTCTGGACTCAAGCCTTCTGGAAGGCGGTCACAGCAGAGTTCCTGGCCATGCTCAT CTTTGTTCTGCTCAGCGTGGGATCCACCATTAACTGGGGTGGCTCAGAGAACCCCCTACCTGTGGACATG GTCCTCATCTCCCTCTGCTTTGGACTCAGCATTGCCACCATGGTTCAGTGCTTCGGCCACATCAGCGGTG GCCACATCAACCCAGCGGTGACAGTGGCCATGGTGTGCACACGAAAGATCAGCATCGCCAAGTCCGTCTT CTACATCACTGCGCAGTGCCTGGGGGCCATCATCGGAGCTGGGATCCTCTACCTGGTCACACCCCCCAGC GTGGTGGGAGGATTGGGAGTCACCACGGTTCATGGAAACCTCACTGCTGGCCATGGGCTCCTGGTGGAGC TAATAATCACTTTCCAGCTGGTATTCACCATTTTTGCCAGCTGTGATTCCAAACGGACTGATGTTACTGG TTCCGTTGCTTTAGCAATTGGGTTTTCCGTTGCAATTGGACATTTGTTTGCAATCAATTATACCGGAGCC AGCATGAATCCAGCTCGATCCTTTGGCCCTGCAGTTATCATGGGAAACTGGGAAAACCACTGGATATATT GGGTTGGACCAATCATAGGCGCTGTGCTGGCAGGTGCACTTTACGAGTATGTCTTCTGTCCTGACGTGGA GCTCAAACGTCGCCTAAAGGAAGCCTTCAGCAAAGCTGCACAGCAGACGAAAGGGAGCTACATGGAGGTG GAGGACAACCGGAGCCAAGTGGAGACAGAAGACTTGATCCTGAAGCCCGGGGTGGTGCATGTGATCGACA TTGACCGTGGAGACGAGAAGAAGGGGAAGGACTCGTCTGGAGAGGTATTATCTTCTGTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_012825 |
| Insert Size | 972 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_012825.3, NP_036957.1 |
| RefSeq Size | 5010 bp |
| RefSeq ORF | 972 bp |
| Locus ID | 25293 |
| UniProt ID | P47863 |
| Gene Summary | This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1, also known as AQP4a) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (M1) results from translation termination at the upstream UGA stop codon, while the longer isoform (M1x) results from UGA stop codon readthrough to the downstream UAA termination codon. This RefSeq represents the shorter isoform (M1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR200435 | Aqp4 (Myc-DDK-tagged ORF) - Rat aquaporin 4 (Aqp4), (10 ug) |
CNY 3990.00 |
|
| RR200435L1 | Lenti ORF clone of Aqp4 (Myc-DDK-tagged ORF) - Rat aquaporin 4 (Aqp4), (10 ug) |
CNY 6080.00 |
|
| RR200435L2 | Lenti ORF clone of Aqp4 (mGFP-tagged ORF) - Rat aquaporin 4 (Aqp4), (10 ug) |
CNY 6240.00 |
|
| RR200435L3 | Lenti ORF clone of Aqp4 (Myc-DDK-tagged ORF) - Rat aquaporin 4 (Aqp4), (10 ug) |
CNY 6080.00 |
|
| RR200435L4 | Lenti ORF clone of Aqp4 (mGFP-tagged ORF) - Rat aquaporin 4 (Aqp4), (10 ug) |
CNY 6650.00 |
