Bag1 (NM_001106647) Rat Untagged Clone

CAT#: RN203877

Bag1 (untagged ORF) - Rat BCL2-associated athanogene (Bag1), (10 ug)



  "NM_001106647" in other vectors (3)

CNY 3990.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Bag-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203877 representing NM_001106647
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

CTGGCGGATCGCGGCGGCGCGCGGCGACCGCGAGGCGACCAGGAGCCGCTGGGACCCCGGCTGCGCGCCC
CTCGGTCGGCCCGGGAGACGCGCCAGTCGGAGTCCCGGGCCGAGCGTGGCTTGCCTCCCTCTCAGCGTTC
ATCTGTCCGCAGTGCAGCCAGCGGGCATGACCGATCCACCAGGGGCGCCGCCTCCGGCGCTTGCAAGCCG
CGGGTGAAGAAGAAAGTCCGGCCCCGCTCTTCTCAGAGCGAGAAGGTAGCTCACAGCAAGGAGTTGACTA
GAAGTAAGAAGTTGACCCGCAGCAAGAAAGTGACCGGGACCCAGGAGGCGACCCAAGTAGAGGAGGTGAC
CACGATCGAGGAGGCGACCCAGACCGAGGAGATTACGGTAGCGGAAGAGGTGACCCAGACCGAGAACATG
GCCCAGACCGAGGAGATGGTCCAGACGGAGGAAATGGAACCACCCACACTCAGCGTGGTCGTCACCCACA
GCAATGAGAGGTATGACCTTCTTGTTACCCCACAGCAAGGTAACAGTGAGCCAATTGTCCAAGACCTGGC
TCAGCTTGTTGAAGAGGCCACAGGAGTTCCACTACCTTTTCAGAAGCTCATATTTAAGGGCAAATCTCTG
AAAGAAATGGAAACACCCTTGTCAGCACTTGGAATGCAAAATGGTTGCCGAGTCATGTTAATTGGTGAAA
AGAGCAATCCAGAAGAAGAGGCTGAGTTGAAAAAGCTGAAGGACTTGGAGGTATCTGTGGAGAAGACAGC
TAACCACCTGGAAGAGTTGAATAAAGAGCTTTCTGACATCCAGCAGGGTTTTCTGGCTAAGGAATTACAA
GCGGAGGCTCTCTGCAGACTTGATAGGAAAATAAAGGCCACAATTGAGCAATTCATGAAGATCTTGGAGG
AGATTGACACAATGGTCCTACCAGAAAACTTTAAAGACAGCAGGCTAAAAAGGAAGAATTTGGTGAAAAA
GGTTCAGGTGTTCCTAGCAGAGTGTGATACAGTGGAGCAGTACATCTGCCAAGAGACAGAGCGGCTGCAG
TCTACAAACTTGGCCCTGCCTGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001106647
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001106647.3, NP_001100117.2
RefSeq Size 1308 bp
RefSeq ORF 1077 bp
Locus ID 297994
UniProt ID B0K019
Gene Summary The oncogene Bcl2 encodes a membrane protein that blocks a step in a pathway leading to apoptosis or programmed cell death. Studies in human and mouse suggest that the protein encoded by this gene (referred to as Bcl2-associated athanogene) binds to Bcl2 protein. It enhances the anti-apoptotic effects of Bcl2 and represents a link between growth factor receptors and anti-apoptotic mechanisms. At least two protein isoforms are encoded by this mRNA through the use of a non-AUG (CUG) start site and an alternative, downstream, AUG translation initiation site. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes multiple isoforms due to the use of alternative translation initiation codons. The longer isoform (BAG-1L or p50) is derived from an upstream non-AUG (CUG) start codon, while the shorter isoform (BAG-1S or p32) is derived from a downstream AUG start codon. The longer isoform (1L) is represented in this RefSeq.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...