Rpl11 (NM_001025739) Rat Untagged Clone
CAT#: RN205184
Rpl11 (untagged ORF) - Rat ribosomal protein L11 (Rpl11), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | MGC114407 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN205184 representing NM_001025739
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGGGAACTTCGTATCCGCAAGCTCTGCCTCAATATCTGCGTGGGGGAGAGTGGAGACAGACTGACCC GAGCAGCCAAGGTGTTGGAGCAGCTCACAGGCCAGACCCCTGTGTTTTCCAAAGCTAGATACACCGTCAG GTCCTTTGGCATCCGGAGAAATGAGAAAATCGCTGTTCACTGCACTGTCCGTGGAGCCAAGGCAGAGGAG ATTCTGGAGAAAGGCCTGAAGGTGCGAGAGTACGAATTACGGAAGAATAACTTCTCAGATACCGGCAACT TTGGCTTTGGGATTCAGGAACACATTGACCTAGGCATCAAATATGACCCAAGCATTGGCATCTATGGCCT GGATTTCTATGTGGTGCTGGGTAGGCCAGGTTTCAGCATCGCAGACAAGAAGCGCAGAACAGGCTGCATT GGGGCCAAACACAGAATCAGCAAAGAGGAGGCCATGCGCTGGTTCCAGCAGAAGTATGATGGCATCATCC TTCCTGGCAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001025739 |
Insert Size | 504 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001025739.1, NP_001020910.1 |
RefSeq Size | 935 bp |
RefSeq ORF | 504 bp |
Locus ID | 362631 |
Gene Summary | Component of the ribosome, a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. The small ribosomal subunit (SSU) binds messenger RNAs (mRNAs) and translates the encoded message by selecting cognate aminoacyl-transfer RNA (tRNA) molecules. The large subunit (LSU) contains the ribosomal catalytic site termed the peptidyl transferase center (PTC), which catalyzes the formation of peptide bonds, thereby polymerizing the amino acids delivered by tRNAs into a polypeptide chain. The nascent polypeptides leave the ribosome through a tunnel in the LSU and interact with protein factors that function in enzymatic processing, targeting, and the membrane insertion of nascent chains at the exit of the ribosomal tunnel. As part of the 5S RNP/5S ribonucleoprotein particle it is an essential component of the LSU, required for its formation and the maturation of rRNAs. It also couples ribosome biogenesis to p53/TP53 activation. As part of the 5S RNP it accumulates in the nucleoplasm and inhibits MDM2, when ribosome biogenesis is perturbed, mediating the stabilization and the activation of TP53. Promotes nucleolar location of PML.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR205184 | Rpl11 (Myc-DDK-tagged ORF) - Rat ribosomal protein L11 (Rpl11), (10 ug) |
CNY 3600.00 |
|
RR205184L3 | Lenti ORF clone of Rpl11 (Myc-DDK-tagged ORF) - Rat ribosomal protein L11 (Rpl11), (10 ug) |
CNY 6080.00 |
|
RR205184L4 | Lenti ORF clone of Rpl11 (mGFP-tagged ORF) - Rat ribosomal protein L11 (Rpl11), (10 ug) |
CNY 6650.00 |