Map1lc3b (NM_022867) Rat Untagged Clone
CAT#: RN209172
Map1lc3b (untagged ORF) - Rat microtubule-associated protein 1 light chain 3 beta (Map1lc3b), (10 ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | LC3B; Map1lc3; Mpl3; zbs559 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN209172 representing NM_022867
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGTCCGAGAAGACCTTCAAACAGCGCCGGAGCTTCGAACAAAGAGTGGAAGATGTCCGGCTCATCC GGGAGCAGCACCCCACCAAGATCCCAGTGATTATAGAGCGATACAAGGGTGAGAAGCAGCTGCCCGTCCT GGACAAGACCAAGTTCCTTGTACCTGATCACGTGAATATGAGCGAACTCATCAAGATAATTAGAAGGCGC CTGCAGCTCAATGCTAACCAAGCCTTCTTCCTCCTGGTGAATGGGCACAGCATGGTGAGTGTGTCCACAC CCATCTCTGAAGTGTACGAGAGCGAGAGAGATGAAGACGGCTTCCTGTACATGGTCTATGCCTCCCAGGA GACGTTCGGGACAGCACTGGCTGTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022867 |
Insert Size | 378 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022867.2, NP_074058.2 |
RefSeq Size | 1768 bp |
RefSeq ORF | 378 bp |
Locus ID | 64862 |
UniProt ID | Q62625 |
Gene Summary | may mediate MAPlA and MAPlB microtubule binding activity during development of the nervous system [RGD, Feb 2006] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR209172 | Map1lc3b (Myc-DDK-tagged ORF) - Rat microtubule-associated protein 1 light chain 3 beta (Map1lc3b), (10 ug) |
CNY 1800.00 |
|
RR209172L3 | Lenti ORF clone of Map1lc3b (Myc-DDK-tagged ORF) - Rat microtubule-associated protein 1 light chain 3 beta (Map1lc3b), (10 ug) |
CNY 6080.00 |
|
RR209172L4 | Lenti ORF clone of Map1lc3b (mGFP-tagged ORF) - Rat microtubule-associated protein 1 light chain 3 beta (Map1lc3b), (10 ug) |
CNY 6650.00 |
其它Map1lc3b产品