Kcnmb1 (NM_019273) Rat Untagged Clone
CAT#: RN211613
Kcnmb1 (untagged ORF) - Rat potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1), (10 ug)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | BKbeta; BKbeta1; k(VCA)beta-1; slo-beta; slo-beta-1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN211613 representing NM_019273
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAAGAAGCTGGTGATGGCCCAGAAGCGCGGAGAGACTCGAGCCCTCTGCCTGGGGGTGGCGATGG TCGTGTGTGCCGCCATCACTTACTACATCCTGGGTACCACTGTGCTGCCCCTCTACCAGAAAAGTGTGTG GACCCAGGAATCCACCTGTCACTTGGTTGAAACCAACATCAAGGACCAGGAAGAGCTGGAGGGCAGGAAG GTGCCCCAGTACCCATGCCTTTGGGTCAATGTATCAGCTGTGGGCAGATGGGCCATGCTGTATCACACAG AAGACACTCGGGATCAAAACCAACAGTGCTCCTATATCCCCAGGAACCTGGACAACTACCAGACAGCCTT GGTTGATGTGAAGAAGGTCAGAGCCAATTTCTACAAACACCATAATTTCTATTGCTTTTCTGCACCTCAA GTCAATGAGACCAGTGTTGTGTACCAGCGCCTCTATGGGCCCCAAATCCTCCTCTTCTCCTTCTTCTGGC CCACCTTCCTGCTGACTGGTGGCCTTCTTATCATTGCCATGGTAAAGCTCAACAGGTCCCTCTCTGTCTT GGCAGCTCAGAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019273 |
| Insert Size | 576 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019273.1, NP_062146.1 |
| RefSeq Size | 1278 bp |
| RefSeq ORF | 576 bp |
| Locus ID | 29747 |
| UniProt ID | P97678 |
| Gene Summary | modulatory subunit of the MaxiK large conductance potassium channel; voltage and calcium-sensitive potassium channel [RGD, Feb 2006] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR211613 | Kcnmb1 (Myc-DDK-tagged ORF) - Rat potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1), (10 ug) |
CNY 3990.00 |
|
| RR211613L3 | Lenti ORF clone of Kcnmb1 (Myc-DDK-tagged ORF) - Rat potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1), (10 ug) |
CNY 6080.00 |
|
| RR211613L4 | Lenti ORF clone of Kcnmb1 (mGFP-tagged ORF) - Rat potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1), (10 ug) |
CNY 6650.00 |

