B7-2 (CD86) (NM_175862) Human Untagged Clone
CAT#: SC101350
CD86 (untagged)-Human CD86 molecule (CD86), transcript variant 1
CNY 3600.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | B7-2; B7.2; B70; CD28LG2; LAB72 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC101350 representing NM_175862.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATCCCCAGTGCACTATGGGACTGAGTAACATTCTCTTTGTGATGGCCTTCCTGCTCTCTGGTGCT GCTCCTCTGAAGATTCAAGCTTATTTCAATGAGACTGCAGACCTGCCATGCCAATTTGCAAACTCTCAA AACCAAAGCCTGAGTGAGCTAGTAGTATTTTGGCAGGACCAGGAAAACTTGGTTCTGAATGAGGTATAC TTAGGCAAAGAGAAATTTGACAGTGTTCATTCCAAGTATATGGGCCGCACAAGTTTTGATTCGGACAGT TGGACCCTGAGACTTCACAATCTTCAGATCAAGGACAAGGGCTTGTATCAATGTATCATCCATCACAAA AAGCCCACAGGAATGATTCGCATCCACCAGATGAATTCTGAACTGTCAGTGCTTGCTAACTTCAGTCAA CCTGAAATAGTACCAATTTCTAATATAACAGAAAATGTGTACATAAATTTGACCTGCTCATCTATACAC GGTTACCCAGAACCTAAGAAGATGAGTGTTTTGCTAAGAACCAAGAATTCAACTATCGAGTATGATGGT ATTATGCAGAAATCTCAAGATAATGTCACAGAACTGTACGACGTTTCCATCAGCTTGTCTGTTTCATTC CCTGATGTTACGAGCAATATGACCATCTTCTGTATTCTGGAAACTGACAAGACGCGGCTTTTATCTTCA CCTTTCTCTATAGAGCTTGAGGACCCTCAGCCTCCCCCAGACCACATTCCTTGGATTACAGCTGTACTT CCAACAGTTATTATATGTGTGATGGTTTTCTGTCTAATTCTATGGAAATGGAAGAAGAAGAAGCGGCCT CGCAACTCTTATAAATGTGGAACCAACACAATGGAGAGGGAAGAGAGTGAACAGACCAAGAAAAGAGAA AAAATCCATATACCTGAAAGATCTGATGAAGCCCAGCGTGTTTTTAAAAGTTCGAAGACATCTTCATGC GACAAAAGTGATACATGTTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_175862 |
| Insert Size | 990 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_175862.4 |
| RefSeq Size | 2735 bp |
| RefSeq ORF | 990 bp |
| Locus ID | 942 |
| UniProt ID | P42081 |
| Protein Families | Druggable Genome, Transcription Factors, Transmembrane |
| Protein Pathways | Allograft rejection, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Toll-like receptor signaling pathway, Type I diabetes mellitus, Viral myocarditis |
| MW | 37.7 kDa |
| Gene Summary | This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011] Transcript Variant: This variant (1) encodes the longest isoform (1) of this protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217341 | CD86 (Myc-DDK-tagged)-Human CD86 molecule (CD86), transcript variant 1 |
CNY 3600.00 |
|
| RC217341L1 | Lenti-ORF clone of CD86 (Myc-DDK-tagged)-Human CD86 molecule (CD86), transcript variant 1 |
CNY 6000.00 |
|
| RC217341L2 | Lenti-ORF clone of CD86 (mGFP-tagged)-Human CD86 molecule (CD86), transcript variant 1 |
CNY 6000.00 |
|
| RC217341L3 | Lenti-ORF clone of CD86 (Myc-DDK-tagged)-Human CD86 molecule (CD86), transcript variant 1 |
CNY 6000.00 |
|
| RC217341L4 | Lenti-ORF clone of CD86 (mGFP-tagged)-Human CD86 molecule (CD86), transcript variant 1 |
CNY 5890.00 |
|
| RG217341 | CD86 (tGFP-tagged) - Human CD86 molecule (CD86), transcript variant 1 |
CNY 5200.00 |

