RUNX1 (NM_001001890) Human Untagged Clone
CAT#: SC106348
RUNX1 (untagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 2
CNY 5488.00
| Cited in 9 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AML1; AML1-EVI-1; AMLCR1; CBF2alpha; CBFA2; EVI-1; PEBP2aB; PEBP2alpha |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001001890 edited
TCATGCGTATCCCCGTAGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGC TGAGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCCCCGGACGCCGGCGCTGCCC TGGCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGG GCGAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGC GCTGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATG GCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATG CTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAA GTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCG CCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATC GGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTG AACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGC CCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGA TGCAGGATACAAGGCAGATCCAACCATCCCCACCGTGGTCCTACGATCAGTCCTACCAAT ACCTGGGATCCATTGCCTCTCCTTCTGTGCACCCAGCAACGCCCATTTCACCTGGACGTG CCAGCGGCATGACAACCCTCTCTGCAGAACTTTCCAGTCGACTCTCAACGGCACCCGACC TGACAGCGTTCAGCGACCCGCGCCAGTTCCCCGCGCTGCCCTCCATCTCCGACCCCCGCA TGCACTATCCAGGCGCCTTCACCTACTCCCCGACGCCGGTCACCTCGGGCATCGGCATCG GCATGTCGGCCATGGGCTCGGCCACGCGCTACCACACCTACCTGCCGCCGCCCTACCCCG GCTCGTCGCAAGCGCAGGGAGGCCCGTTCCAAGCCAGCTCGCCCTCCTACCACCTGTACT ACGGCGCCTCGGCCGGCTCCTACCAGTTCTCCATGGTGGGCGGCGAGCGCTCGCCGCCGC GCATCCTGCCGCCCTGCACCAACGCCTCCACCGGCTCCGCGCTGCTCAACCCCAGCCTCC CGAACCAGAGCGACGTGGTGGAGGCCGAGGGCAGCCACAGCAACTCCCCCACCAACATGG CGCCCTCCGCGCGCCTGGAGGAGGCCGTGTGGAGGCCCTACTGAGGCGCCAGGCCTGGCC CGGCTGGGCCCCGCGGGCCGCCGCCTTCGCCTCCGGGCGCGCGGGCCTCCTGTTCGCGAC AAGCCCGCCGGGATCCCGGGCCCTGGGCCCGGCCACCGTCCTGGGGCCGAGGGCGCCCGA CGGCCAGGATCTCGCTGTAGGTCAGGCCCGCGCAGCCTCCTGCGCCCAGAAGCCCACGCC GCCGCCGTCTGCTGGCGCCCCGGCCCTCGCGGAGGTGTCCGAGGCGACGCACCTCGAGGG TGTCCGCCGGCCCCAGCACCCAGGGGACGCGCTGGAAAGCAAACAGGAAGATTCCCGGAG GGAAACTGTGAATGCTTCTGATTTAGCAATGCTGTGAATAAAAAGAAAGATTTTATACCC TTGAAAAAAAAAAAAAAAAAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001001890 |
| Insert Size | 1700 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001001890.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001001890.1, NP_001001890.1 |
| RefSeq Size | 7288 bp |
| RefSeq ORF | 1362 bp |
| Locus ID | 861 |
| UniProt ID | Q01196 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
| Protein Pathways | Acute myeloid leukemia, Chronic myeloid leukemia, Pathways in cancer |
| Gene Summary | Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (AML1b) is shorter and has a distinct N-terminus compared to isoform AML1c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Citations (9)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Defective RAB1B-related megakaryocytic ER-to-Golgi transport in RUNX1 haplodeficiency: impact on von Willebrand factor
,Jalagadugula, G;Goldfinger, LE;Mao, G;Lambert, MP;Rao, AK;,
Blood Adv
,PubMed ID 29632235
[RUNX1]
|
|
Transcription Factor RUNX1 Regulates Platelet PCTP (Phosphatidylcholine Transfer Protein): Implications for Cardiovascular Events: Differential Effects of RUNX1 Variants
,Mao, G;Songdej, N;Voora, D;Goldfinger, LE;Del Carpio-Cano, FE;Myers, RA;Rao, AK;,
Circulation
,PubMed ID 28676520
[RUNX1]
|
|
Dysregulation of PLDN (pallidin) is a mechanism for platelet dense granule deficiency in RUNX1 haplodeficiency
,Mao, GF;Goldfinger, LE;Fan, DC;Lambert, MP;Jalagadugula, G;Freishtat, R;Rao, AK;,
J. Thromb. Haemost.
,PubMed ID 28075530
[RUNX1]
|
|
Platelet Protein Kinase C-{theta} Deficiency With Human RUNX1 Mutation: PRKCQ Is a Transcriptional Target of RUNX1
,Gauthami Jalagadugula, Guangfen Mao, Gurpreet Kaur, Danny N. Dhanasekaran, and A. Koneti Rao,
Arterioscler Thromb Vasc Biol, Apr 2011; 31: 921 - 927
[RUNX1]
|
|
Regulation of platelet myosin light chain (MYL9) by RUNX1: implications for thrombocytopenia and platelet dysfunction in RUNX1 haplodeficiency
,Gauthami Jalagadugula, Guangfen Mao, Gurpreet Kaur, Lawrence E. Goldfinger, Danny N. Dhanasekaran, and A. Koneti Rao,
Blood, Dec 2010; 116: 6037 - 6045
[RUNX1]
|
|
Regulation of platelet myosin light chain (MYL9) by RUNX1: implications for thrombocytopenia and platelet dysfunction in RUNX1 haplodeficiency
,null,
Blood
,PubMed ID 20876458
[RUNX1]
|
|
AML1 is overexpressed in patients with myeloproliferative neoplasms and mediates JAK2V617F-independent overexpression of NF-E2
,Wei Wang, Sven Schwemmers, Elizabeth O. Hexner, and Heike L. Pahl,
Blood, Jul 2010; 116: 254 - 266
[RUNX1]
|
|
RUNX1/core binding factor A2 regulates platelet 12-lipoxygenase gene (ALOX12): studies in human RUNX1 haplodeficiency
,null,
Blood
,PubMed ID 20181616
[RUNX1]
|
|
RUNX1/core binding factor A2 regulates platelet 12-lipoxygenase gene (ALOX12): studies in human RUNX1 haplodeficiency
,Gurpreet Kaur, Gauthami Jalagadugula, Guangfen Mao, and A. Koneti Rao,
Blood, Apr 2010; 115: 3128 - 3135
[RUNX1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223854 | RUNX1 (Myc-DDK-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 2 |
CNY 5488.00 |
|
| RC223854L1 | Lenti-ORF clone of RUNX1 (Myc-DDK-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 2 |
CNY 7888.00 |
|
| RC223854L2 | Lenti-ORF clone of RUNX1 (mGFP-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 2 |
CNY 5890.00 |
|
| RC223854L3 | Lenti-ORF clone of RUNX1 (Myc-DDK-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 2 |
CNY 5890.00 |
|
| RC223854L4 | Lenti-ORF clone of RUNX1 (mGFP-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 2 |
CNY 7888.00 |
|
| RG223854 | RUNX1 (tGFP-tagged) - Human runt-related transcription factor 1 (RUNX1), transcript variant 2 |
CNY 4370.00 |
