ANAPC13 (NM_015391) Human Untagged Clone

CAT#: SC107373

ANAPC13 (untagged)-Human anaphase promoting complex subunit 13 (ANAPC13), transcript variant 1



  "NM_015391" in other vectors (4)

CNY 1200.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ANAPC13 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APC13; SWM1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_015391 edited
ATGGACAGTGAGGTTCAGAGAGATGGAAGGATCTTGGATTTGATTGATGATGCTTGGCGA
GAAGACAAGCTGCCTTATGAGGATGTCGCAATACCACTGAATGAGCTTCCTGAACCTGAA
CAAGACAATGGTGGCACCACAGAATCTGTCAAAGAACAAGAAATGAAGTGGACAGACTTA
GCCTTACAGTACCTCCATGAGAATGTTCCCCCCATTGGAAACTGA
>OriGene 5' read for NM_015391 unedited
ATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTCTGCCGCGGT
GGCCGGGTGCCGATTTGACAAGATCAAAGCTGCAGGAAAATGGACAGTGAGGTTCAGAGA
GATGGAAGGATCTTGGATTTGATTGATGATGCTTGGCGAGAAGACAAGCTGCCTTATGAG
GATGTCGCAATACCACTGAATGAGCTTCCTGAACCTGAACAAGACAATGGTGGCACCACA
GAATCTGTCAAAGAACAAGAAATGAAGTGGACAGACTTAGCCTTACAGTACCTCCATGAG
AATGTTCCCCCCATTGGAAACTGACGCTTGGCTCCTTTCTTGTGGATGGATTTTCTCAAA
GTACACAGATAAAGCATGGTTTGTTTCAGTCTCCAAATTCAAACCTTTGAGTAATAAATC
AGCACTCAAAAATGTACACCCATTTAGTTTGTGGTAGCAAAGTGCAATGCGAAATTGAAT
GAGAAACTGAGATTTCTCAGTAATGGTGAATATTTCGCTCTTTAAACCTAAAACTCTTCA
TTGAGTAGCTTATATTTGAACATGATTGGTTAAACATTTGCCTCTACCTCTGATTTTGCT
TTGCTGTCAAAGTTTAACACCTTCCAACTACTTATGTGTGTCCTGTAACACAGGTGATTG
AACGTATGAGAGGGAAAGGCAAAGAANAAGGAAGCCAGACACTANGAGAATTATTAACTT
CTCATACTTCCCCACATTGAGAAGCATTCGGAGTGTATTTAGCCTGTAGATGTTGTGATA
TGCAAATATCCCATTCCCTGGNTACTGGCATTCCTAAGATTCTTCATGGNTATTTCAAAC
TTTGGATAAATTACAGATTAAAAGATTCTGACAGTTAT
Restriction Sites NotI-NotI     
ACCN NM_015391
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_015391.1, NP_056206.1
RefSeq Size 1201 bp
RefSeq ORF 225 bp
Locus ID 25847
UniProt ID Q9BS18
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
Gene Summary This gene encodes a component of the anaphase promoting complex, a large ubiquitin-protein ligase that controls cell cycle progression by regulating the degradation of cell cycle regulators such as B-type cyclins. The encoded protein is evolutionarily conserved and is required for the integrity and ubiquitin ligase activity of the anaphase promoting complex. Pseudogenes and splice variants have been found for this gene; however, the biological validity of some of the splice variants has not been determined. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 2. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...