Caspase 4 (CASP4) (NM_033307) Human Untagged Clone

CAT#: SC107961

CASP4 (untagged)-Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant delta



CNY 1200.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
CASP4 mouse monoclonal antibody, clone OTI4A2 (formerly 4A2)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms apoptotic cysteine protease Mih1/TX; Caspase 4; caspase 4, apoptosis-related cysteine peptidase; caspase 4, apoptosis-related cysteine protease; ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX; TX, ICH-2, Mih1/TX, ICEREL-II, ICE(rel)II
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_033307, the custom clone sequence may differ by one or more nucleotides


ATGGCAGAAGGCAACCACAGAAAAAAGCCACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCACTG
GTGTTTTGGATAACTTGGTGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAAAGAAATATTACGA
TGCTAAAACTGAAGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACAA
ATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGGTGATAAATTGGGTCACA
GAGGCAGAAATCACAATTTATGTTCTGCAATATCCTGCAGCTCATCCGAATATGGAGGCTGGACCACCTG
A


>OriGene 5' read for NM_033307 unedited
GACTNTCGCATTAGGAAGACAGATTTTGTTCCCTATGGCAGGCAACCACAGCAAAAAAGC
CACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCACTGGTGTTTTGGATAACTTGG
TGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAAAGAAATATTACGATGCTAAAT
CNGAGACAAAGTTTGGGTCATGGTAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACA
AATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGCTCATCC
GAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGCTTTGTCC
TCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCAATAAAGGA
GAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGACCATCTGCC
TCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAGGGTCTGGA
CTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCGCTGAGGGC
ATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCACATTCTTGGTACTCAATTCTCA
TGGCATCCTGGAAGGAATCTGCGGAACTGTGCATGATGAGAAAAAAACCAGATGTGCCTG
CTTATGACACCATCTTCCAGATATTTCACAACCGCAACCTGCCTCAGTCTGAAGGACAAA
CCCCAAGGTCTTATTGTCCAGGCCTGCAGAGTTGCAAACCGTGGGGAACTGTGGGTCAGA
GACTCTCCAGCATCCTTGAAAGTGGCCTTCTCACAGTCATCTG
Restriction Sites NotI-NotI     
ACCN NM_033307
Insert Size 1320 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033307.2, NP_150650.2
RefSeq Size 1327 bp
RefSeq ORF 351 bp
Locus ID 837
Domains Peptidase_C14
Protein Families Druggable Genome, Protease
Gene Summary This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (delta) contains a unique internal fragment absent in variant alpha, which leads to a translation frameshift. Two polypeptides are produced from this variant. One corresponds to the N-terminal portion of isoform alpha and has a distinct C-terminus; another is identical to the N-terminal truncated isoform alpha.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...