GRP78 (HSPA5) (NM_005347) Human Untagged Clone
CAT#: SC108086
HSPA5 (untagged)-Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5)
CNY 4880.00
Cited in 9 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BIP; GRP78; HEL-S-89n |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC108086 sequence for NM_005347 edited (data generated by NextGen Sequencing)
ATGAAGCTCTCCCTGGTGGCCGCGATGCTGCTGCTGCTCAGCGCGGCGCGGGCCGAGGAG GAGGACAAGAAGGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCC TGCGTCGGCGTGTTCAAGAACGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGC ATCACGCCGTCCTATGTCGCCTTCACTCCTGAAGGGGAACGTCTGATTGGCGATGCCGCC AAGAACCAGCTCACCTCCAACCCCGAGAACACGGTCTTTGACGCCAAGCGGCTCATCGGC CGCACGTGGAATGACCCGTCTGTGCAGCAGGACATCAAGTTCTTGCCGTTCAAGGTGGTT GAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGGCAAACAAAGACATTT GCTCCTGAAGAAATTTCTGCCATGGTTCTCACTAAAATGAAAGAAACCGCTGAGGCTTAT TTGGGAAAGAAGGTTACCCATGCAGTTGTTACTGTACCAGCCTATTTTAATGATGCCCAA CGCCAAGCAACCAAAGACGCTGGAACTATTGCTGGCCTAAATGTTATGAGGATCATCAAC GAGCCTACGGCAGCTGCTATTGCTTATGGCCTGGATAAGAGGGAGGGGGAGAAGAACATC CTGGTGTTTGACCTGGGTGGCGGAACCTTCGATGTGTCTCTTCTCACCATTGACAATGGT GTCTTCGAAGTTGTGGCCACTAATGGAGATACTCATCTGGGTGGAGAAGACTTTGACCAG CGTGTCATGGAACACTTCATCAAACTGTACAAAAAGAAGACGGGCAAAGATGTCAGGAAA GACAATAGAGCTGTGCAGAAACTCCGGCGCGAGGTAGAAAAGGCCAAACGGGCCCTGTCT TCTCAGCATCAAGCAAGAATTGAAATTGAGTCCTTCTATGAAGGAGAAGACTTTTCTGAG ACCCTGACTCGGGCCAAATTTGAAGAGCTCAACATGGATCTGTTCCGGTCTACTATGAAG CCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTT CTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAAT GGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTC CAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGT CCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAAC ACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACT GTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAAAGACAATCATCTTCTGGGT ACATTTGATCTGACTGGAATTCCTCCTGCTCCTCGTGGGGTCCCACAGATTGAAGTCACC TTTGAGATAGATGTGAATGGTATTCTTCGAGTGACAGCTGAAGACAAGGGTACAGGGAAC AAAAATAAGATCACAATCACCAATGACCAGAATCGCCTGACACCTGAAGAAATCGAAAGG ATGGTTAATGATGCTGAGAAGTTTGCTGAGGAAGACAAAAAGCTCAAGGAGCGCATTGAT ACTAGAAATGAGTTGGAAAGCTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAA AAGCTGGGAGGTAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCTGTAGAAGAA AAGATTGAATGGCTGGAAAGCCACCAAGATGCTGACATTGAAGACTTCAAAGCTAAGAAG AAGGAACTGGAAGAAATTGTTCAACCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCT CCCCCAACTGGTGAAGAGGATACAGCAGAAAAAGATGAGTTGTAG Clone variation with respect to NM_005347.4 |
Restriction Sites | Please inquire |
ACCN | NM_005347 |
Insert Size | 2500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005347.2, NP_005338.1 |
RefSeq Size | 3925 bp |
RefSeq ORF | 1965 bp |
Locus ID | 3309 |
UniProt ID | P11021 |
Domains | HSP70 |
Protein Families | Druggable Genome |
Protein Pathways | Antigen processing and presentation, Prion diseases |
Gene Summary | The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. This protein localizes to the lumen of the endoplasmic reticulum (ER) where it operates as a typical HSP70 chaperone involved in the folding and assembly of proteins in the ER and is a master regulator of ER homeostasis. During cellular stress, as during viral infection or tumorogenesis, this protein interacts with the transmembrane stress sensor proteins PERK (protein kinase R-like endoplasmic reticulum kinase), IRE1 (inositol-requiring kinase 1), and ATF6 (activating transcription factor 6) where it acts as a repressor of the unfolded protein response (UPR) and also plays a role in cellular apoptosis and senescence. Elevated expression and atypical translocation of this protein to the cell surface has been reported in viral infections and some types of cancer cells. At the cell surface this protein may facilitate viral attachment and entry to host cells. This gene is a therapeutic target for the treatment of coronavirus diseases and chemoresistant cancers. [provided by RefSeq, Jul 2020] |
Citations (9)
The use of this cDNA Clones has been cited in the following citations: |
---|
HHQ-4, a quinoline derivate, preferentially inhibits proliferation of glucose-deprived breast cancer cells as a GRP78 down-regulator
,Xiao, X;Li, S;Zhang, X;Lu, J;Wang, W;Zhou, S;Zhang, J;Wang, R;Li, A;,
Toxicol. Appl. Pharmacol.
,PubMed ID 31022492
[HSPA5]
|
Glucose-regulated protein 78 demonstrates antiviral effects but is more suitable for hepatocellular carcinoma prevention in hepatitis B
,Zheng, NQ;Zheng, ZH;Xu, HX;Huang, MX;Peng, XM;,
Virol. J.
,PubMed ID 28407787
[HSPA5]
|
Discovery of a Novel Target for the Dysglycemic Chromogranin A Fragment Pancreastatin: Interaction with the Chaperone GRP78 to Influence Metabolism
,Biswas, N;Friese, RS;Gayen, JR;Bandyopadhyay, G;Mahata, SK;O'Connor, DT;,
PLoS ONE, Jan 2014.
,PubMed ID 24465394
[HSPA5]
|
Model-directed engineering of difficult-to-express monoclonal antibody production by Chinese hamster ovary cells
,Pybus, LP;Dean, G;West, NR;Smith, A;Daramola, O;Field, R;Wilkinson, SJ;James, DC;,
Biotechnol Bioeng. 2013 Sep 21
,PubMed ID 24081924
[HSPA5]
|
Androgen receptor inclusions acquire GRP78/BiP to ameliorate androgen-induced protein misfolding stress in embryonic stem cells
,Y-C Yang, H-C Fu, B-L Hsiao, G Sobue, H Adachi, + et al.,
Cell Death and Disease 4, e607 doi:10.1038/cddis.2013.122
,PubMed ID 23618905
[HSPA5]
|
Glucose-Regulated Protein 78 Controls Cross-talk between Apoptosis and Autophagy to Determine Antiestrogen Responsiveness
,Katherine L. Cook, Ayesha N. Shajahan, Anni Wärri, Lu Jin, Leena A. Hilakivi-Clarke, and Robert Clarke,
Cancer Res., Jul 2012; 72: 3337 - 3349.
[HSPA5]
|
Proteomic Assessment Shows That Many Endoplasmic Reticulum (ER)-resident Proteins Are Targeted by N-Lysine Acetylation in the Lumen of the Organelle and Predicts Broad Biological Impact
,Mariana Pehar, Massimiliano Lehnus, Anna Karst, and Luigi Puglielli,
J. Biol. Chem., Jun 2012; 287: 22436 - 22440.
[HSPA5]
|
GRP78 regulates clusterin stability, retrotranslocation and mitochondrial localization under ER stress in prostate cancer
,N Li, A Zoubeidi, E Beraldi & M E Gleave,
Oncogene doi:10.1038/onc.2012.212
[HSPA5]
|
Proteomic Assessment Shows That Many Endoplasmic Reticulum (ER)-resident Proteins Are Targeted by Nϵ-Lysine Acetylation in the Lumen of the Organelle and Predicts Broad Biological Impact *
,null,
The Journal of Biological Chemistry
,PubMed ID 22628546
[HSPA5]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205859 | HSPA5 (Myc-DDK-tagged)-Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5) |
CNY 4872.00 |
|
RC205859L1 | Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), Myc-DDK-tagged |
CNY 7272.00 |
|
RC205859L2 | Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), mGFP tagged |
CNY 7272.00 |
|
RC205859L3 | Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), Myc-DDK-tagged |
CNY 7272.00 |
|
RC205859L4 | Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), mGFP tagged |
CNY 7272.00 |
|
RG205859 | HSPA5 (tGFP-tagged) - Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5) |
CNY 6472.00 |