DDX56 (NM_019082) Human Untagged Clone
CAT#: SC108616
DDX56 (untagged)-Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56)
CNY 6120.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DDX21; DDX26; NOH61 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_019082, the custom clone sequence may differ by one or more nucleotides
ATGGAGGACTCTGAAGCACTGGGCTTCGAACACATGGGCCTCGATCCCCGGCTCCTTCAGGCTGTCACCG ATCTGGGCTGGTCGCGACCTACGCTGATCCAGGAGAAGGCCATCCCACTGGCCCTAGAAGGGAAGGACCT CCTGGCTCGGGCCCGCACGGGCTCCGGGAAGACGGCCGCTTATGCTATTCCGATGCTGCAGCTGTTGCTC CATAGGAAGGCGACAGGTCCGGTGGTAGAACAGGCAGTGAGAGGCCTTGTTCTTGTTCCTACCAAGGAGC TGGCACGGCAAGCACAGTCCATGATTCAGCAGCTGGCTACCTACTGTGCTCGGGATGTCCGAGTGGCCAA TGTCTCAGCTGCTGAAGACTCAGTCTCTCAGAGAGCTGTGCTGATGGAGAAGCCAGATGTGGTAGTAGGG ACCCCATCTCGCATATTAAGCCACTTGCAGCAAGACAGCCTGAAACTTCGTGACTCCCTGGAGCTTTTGG TGGTGGACGAAGCTGACCTTCTTTTTTCCTTTGGCTTTGAAGAAGAGCTCAAGAGTCTCCTCTGTCACTT GCCCCGGATTTACCAGGCTTTTCTCATGTCAGCTACTTTTAACGAGGACGTACAAGCACTCAAGGAGCTG ATATTACATAACCCGGTTACCCTTAAGTTACAGGAGTCCCAGCTGCCTGGGCCAGACCAGTTACAGCAGT TTCAGGTGGTCTGTGAGACTGAGGAAGACAAATTCCTCCTGCTGTATGCCCTGCTCAAGCTGTCATTGAT TCGGGGCAAGTCTCTGCTCTTTGTCAACACTCTAGAACGGAGTTACCGGCTACGCCTGTTCTTGGAACAG TTCAGCATCCCCACCTGTGTGCTCAATGGAGAGCTTCCACTGCGCTCCAGGTGCCACATCATCTCACAGT TCAACCAAGGCTTCTACGACTGTGTCATAGCAACTGATGCTGAAGTCCTGGGGGCCCCAGTCAAGGGCAA GCGTCGGGGCCGAGGGCCCAAAGGGGACAAGGCCTCTGATCCGGAAGCAGGTGTGGCCCGGGGCATAGAC TTCCACCATGTGTCTGCTGTGCTCAACTTTGATCTTCCCCCAACCCCTGAGGCCTACATCCATCGAGCTG GCAGGACAGCACGCGCTAACAACCCAGGCATAGTCTTAACCTTTGTGCTTCCCACGGAGCAGTTCCACTT AGGCAAGATTGAGGAGCTTCTCAGTGGAGAGAACAGGGGCCCCATTCTGCTCCCCTACCAGTTCCGGATG GAGGAGATCGAGGGCTTCCGCTATCGCTGCAGGGATGCCATGCGCTCAGTGACTAAGCAGGCCATTCGGG AGGCAAGATTGAAGGAGATCAAGGAAGAGCTTCTGCATTCTGAGAAGCTTAAGACATACTTTGAAGACAA CCCTAGGGACCTCCAGCTGCTGCGGCATGACCTACCTTTGCACCCCGCAGTGGTGAAGCCCCACCTGGGC CATGTTCCTGACTACCTGGTTCCTCCTGCTCTCCGTGGCCTGGTGCGCCCTCACAAGAAGCGGAAGAAGC TGTCTTCCTCTTGTAGGAAGGCCAAGAGAGCAAAGTCCCAGAACCCACTGCGCAGCTTCAAGCACAAAGG AAAGAAATTCAGACCCACAGCCAAGCCCTCCTGA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | NotI-NotI |
| ACCN | NM_019082 |
| Insert Size | 2570 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019082.2, NP_061955.1 |
| RefSeq Size | 2499 bp |
| RefSeq ORF | 1644 bp |
| Locus ID | 54606 |
| UniProt ID | Q9NY93 |
| Domains | DEAD, helicase_C |
| Gene Summary | This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene shows ATPase activity in the presence of polynucleotides and associates with nucleoplasmic 65S preribosomal particles. This gene may be involved in ribosome synthesis, most likely during assembly of the large 60S ribosomal subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201477 | DDX56 (Myc-DDK-tagged)-Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56) |
CNY 6112.00 |
|
| RC201477L1 | Lenti ORF clone of Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56), Myc-DDK-tagged |
CNY 8512.00 |
|
| RC201477L2 | Lenti ORF clone of Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56), mGFP tagged |
CNY 5890.00 |
|
| RC201477L3 | Lenti ORF clone of Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201477L4 | Lenti ORF clone of Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56), mGFP tagged |
CNY 5890.00 |
|
| RG201477 | DDX56 (tGFP-tagged) - Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56) |
CNY 7712.00 |
|
| SC322205 | DDX56 (untagged)-Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56) |
CNY 6120.00 |

