GH2 (NM_022557) Human Untagged Clone

CAT#: SC109273

GH2 (untagged)-Human growth hormone 2 (GH2), transcript variant 2



  "NM_022557" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
GH2 mouse monoclonal antibody,clone OTI5B11
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GH-V; GHB2; GHL; GHV; hGH-V
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_022557, the custom clone sequence may differ by one or more nucleotides


ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGTCCTGGCTTCAAGAGG
GCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCGTCGCCTGTA
CCAGCTGGCATATGACACCTATCAGGAGTTTGAAGAAGCCTATATCCTGAAGGAGCAGAAGTATTCATTC
CTGCAGAACCCCCAGACCTCCCTCTGCTTCTCAGAGTCTATTCCAACACCTTCCAACAGGGTGAAAACGC
AGCAGAAATCTAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCATGGCTGGAGCCCGTGCA
GCTCCTCAGGAGCGTCTTCGCCAACAGCCTGGTGTATGGCGCCTCGGACAGCAACGTCTATCGCCACCTG
AAGGACCTAGAGGAAGGCATCCAAACGCTGATGTGGGTGAGGGTGGCACCAGGGATCCCCAATCCTGGGG
CCCCACTGGCTTCCAGGGACTGGGGAGAGAAACACTGCTGCCCTCTTTTTAGCAGTCAGGCGCTGACCCA
AGAGAACTCACCGTATTCTTCATTTCCCCTCGTGAATCCTCCAGGCCTTTCTCTACAACCTGGAGGGGAG
GGAGGAAAATGGATGAATGAGAGAGGGAGGGAACAGTGCCCAAGCGCTTGGCCTCTCCTTCTCTTCCTTC
ACTTTGCAGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAATCAGTCCTACAGCAAGTTTG
A


Restriction Sites Please inquire     
ACCN NM_022557
Insert Size 860 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022557.2, NP_072051.1
RefSeq Size 1078 bp
RefSeq ORF 771 bp
Locus ID 2689
UniProt ID P01242
Domains hormone
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. As in the case of its pituitary counterpart, growth hormone 1, the predominant isoform of this particular family member shows similar somatogenic activity, with reduced lactogenic activity. Mutations in this gene lead to placental growth hormone/lactogen deficiency. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) utilizes intron D to generate the longest isoform (2), which diverges from all other GH isoforms in the carboxy terminus.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...