PLK1 (NM_005030) Human Untagged Clone
CAT#: SC110978
PLK1 (untagged)-Human polo-like kinase 1 (PLK1)
CNY 6744.00
| Cited in 9 publications. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PLK; STPK13 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_005030, the custom clone sequence may differ by one or more nucleotides
ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCCGGGGTCCCCG GAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATCCCGGAGGTCCTAGTGGACCC ACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGCAAGGGCGGCTTTGCCAAGTGCTTCGAGATC TCGGACGCGGACACCAAGGAGGTGTTCGCGGGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACC AGAGGGAGAAGATGTCCATGGAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCA CGGCTTTTTCGAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAG CTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATTGTGCTTGGCT GCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGA TCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACC CTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATG TGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAA AGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCC CTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTTAATGACGAGT TCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACCATTCCACCAAGGTTTTCGAT TGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTCACAGTCCTCAATAAAGGCTTGGAGAACCCC CTGCCTGAGCGTCCCCGGGAAAAAGAAGAACCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACC TCAGTGACATGCTGCAGCAGCTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCA AGAGGAGGCTGAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAG TACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACACGCCTCATCC TCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAGTCCTACCTCACCGTGAGTTC CCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAATATTTCCGCAATTACATGAGCGAGCACTTG CTGAAGGCAGGTGCCAACATCACGCCGCGCGAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCT GGTTCCGCACCCGCAGCGCCATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGA TCACACCAAGCTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGC ACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTCCGCTACGCCC GCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTCAAGGCCTCCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_005030 |
| Insert Size | 2300 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005030.3, NP_005021.2 |
| RefSeq Size | 2204 bp |
| RefSeq ORF | 1812 bp |
| Locus ID | 5347 |
| UniProt ID | P53350 |
| Domains | pkinase, POLO_box, TyrKc, S_TKc |
| Protein Families | Druggable Genome, Protein Kinase |
| Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation |
| Gene Summary | The Ser/Thr protein kinase encoded by this gene belongs to the CDC5/Polo subfamily. It is highly expressed during mitosis and elevated levels are found in many different types of cancer. Depletion of this protein in cancer cells dramatically inhibited cell proliferation and induced apoptosis; hence, it is a target for cancer therapy. [provided by RefSeq, Sep 2015] |
Citations (9)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
PLK1 and AURKB phosphorylate survivin differentially to affect proliferation in racially distinct triple-negative breast cancer
,null,
Cell Death & Disease
,PubMed ID 36627281
[PLK1]
|
|
Synergistic apoptotic effect of miR-183-5p and Polo-Like kinase 1 inhibitor NMS-P937 in breast cancer cells
,null,
Cell Death and Differentiation
,PubMed ID 34561554
[PLK1]
|
|
PLK1 (polo like kinase 1)-dependent autophagy facilitates gefitinib-induced hepatotoxicity by degrading COX6A1 (cytochrome c oxidase subunit 6A1)
,Luo, P;Yan, H;Du, J;Chen, X;Shao, J;Zhang, Y;Xu, Z;Jin, Y;Lin, N;Yang, B;He, Q;,
Autophagy
,PubMed ID 33315519
[PLK1]
|
|
Dasatinib synergises with irinotecan to suppress hepatocellular carcinoma via inhibiting the protein synthesis of PLK1
,Xu, L;Zhu, Y;Shao, J;Chen, M;Yan, H;Li, G;Zhu, Y;Xu, Z;Yang, B;Luo, P;He, Q;,
Br. J. Cancer
,PubMed ID 28267710
[PLK1]
|
|
PLK1 Inhibitors Synergistically Potentiate HDAC Inhibitor Lethality in Imatinib Mesylate–Sensitive or –Resistant BCR/ABL+ Leukemia Cells In Vitro and In Vivo
,Girija Dasmahapatra, Hiral Patel, Tri Nguyen, Elisa Attkisson, and Steven Grant,
Clin. Cancer Res., Jan 2013; 19: 404 - 414.
[PLK1]
|
|
The Scaffold Protein TANK/I-TRAF Inhibits NF-{kappa}B Activation by Recruiting Polo-like Kinase 1
,Wanqiao Zhang, Jian Wang, Ying Zhang, Yanzhi Yuan, Wei Guan, Chaozhi Jin, Hui Chen, Xiaohui Wang, Xiaoming Yang, and Fuchu He,
Mol. Biol. Cell, Jul 2010; 21: 2500 - 2513
[PLK1]
|
|
Prostaglandin (PG)D2 and 15-deoxy-?12,14-PGJ2, but not PGE2, mediate shear-induced chondrocyte apoptosis via protein kinase A-dependent regulation of polo-like kinases
,F Zhu, P Wang, A Kontrogianni-Konstantopoulos, K Konstantopoulos,
Cell Death and Differentiation (12 February 2010) doi:10.1038/cdd.2010.13 Original Paper
[PLK1]
|
|
Prostaglandin (PG)D2 and 15-deoxy-?12,14-PGJ2, but not PGE2, Mediate Shear-Induced Chondrocyte Apoptosis via Protein Kinase A-dependent Regulation of Polo-like Kinases
,null,
Cell death and differentiation
,PubMed ID 20150912
[PLK1]
|
|
Henipavirus V Protein Association with Polo-Like Kinase Reveals Functional Overlap with STAT1 Binding and Interferon Evasion
,Louise E. Ludlow, Michael K. Lo, Jason J. Rodriguez, Paul A. Rota, and Curt M. Horvath,
J. Virol., Jul 2008; 82: 6259 - 6271.
[PLK1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201795 | PLK1 (Myc-DDK-tagged)-Human polo-like kinase 1 (PLK1) |
CNY 6736.00 |
|
| RC201795L1 | Lenti ORF clone of Human polo-like kinase 1 (PLK1), Myc-DDK-tagged |
CNY 9136.00 |
|
| RC201795L2 | Lenti ORF clone of Human polo-like kinase 1 (PLK1), mGFP tagged |
CNY 9136.00 |
|
| RC201795L3 | Lenti ORF clone of Human polo-like kinase 1 (PLK1), Myc-DDK-tagged |
CNY 9136.00 |
|
| RC201795L4 | Lenti ORF clone of Human polo-like kinase 1 (PLK1), mGFP tagged |
CNY 9136.00 |
|
| RG201795 | PLK1 (tGFP-tagged) - Human polo-like kinase 1 (PLK1) |
CNY 8336.00 |
|
| SC323363 | PLK1 (untagged)-Kinase deficient mutant (K82M) of Human polo-like kinase 1 (Drosophila) (PLK1) |
CNY 6744.00 |
