ROC2 (RNF7) (NM_014245) Human Untagged Clone

CAT#: SC111737

RNF7 (untagged)-Human ring finger protein 7 (RNF7), transcript variant 1



  "NM_014245" in other vectors (6)

CNY 1200.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RNF7 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CKBBP1; rbx2; ROC2; SAG
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC111737 sequence for NM_014245 edited (data generated by NextGen Sequencing)
ATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGGGAGCTCA
GGCTCCAAGTCGGGAGGCGACAAGATGTTCTCCCTCAAGAAGTGGAACGCGGTGGCCATG
TGGANCTGGGACGTGGAGTGCGATACGTGCGCCATCTGCAGGGTCCAGGTGATGGATGCC
TGTCTTAGATGTCAAGCTGAAAACAAACAAGAGGACTGTGTTGTGGTCTGGGGAGAATGT
AATCATTCCTTCCACAACTGCTGCATGTCCCTGTGGGTGAAACAGAACAATCGCTGCCCT
CTCTGCCAGCAGGACTGGGTGGTCCAAAGAATCGGCAAATGA

Clone variation with respect to NM_014245.4
125 g=>n
>OriGene 5' read for NM_014245 unedited
GCACGAGGGCGCCGCCATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTC
TCACTCCGGGAGCTCAGGCTCCAAGTCGGGAGGCGACAAGATGTTCTCCCTCAAGAAGTG
GAACGCGGTGGCCATGTGGAGCTGGGACGTGGAGTGCGATACGTGCGCCATCTGCAGGGT
CCAGGTGATGGATGCCTGTCTTAGATGTCAAGCTGAAAACAAACAAGAGGACTGTGTTGT
GGTCTGGGGAGAATGTAATCATTCCTTCCACAACTGCTGCATGTCCCTGTGGGTGAAACA
GAACAATCGCTGCCCTCTCTGCCAGCAGGACTGGGTGGTCCAAAGAATCGGCAAATGAGA
GTGGTTAGAAGGCTTCTTAGCGCAGTTGTTCAGAGCCCTGGTGGATCTTGTAATCCAGTG
CCCTACAAAGGCTAGAACACTACAGGGGATGAATTCTTCAAATAGGAGCCGATGGATCTG
TGGTCCTTTGGGACTCATCAAAGCCTTGGTTTAGCATTTTGTCAGTTTTATCTTCAGAAA
TTCTCTGCGATTAAGAAGATAATTTATTAAAGGTGGTCCTTCCTACCTCTGTGGTGGTGT
GTCGCGCACACAGCTTAGAAGTGCTATAAAAAAGGAAAGAGCTCCAAATTGAATCACCT
Restriction Sites NotI-NotI     
ACCN NM_014245
Insert Size 2770 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_014245.2, NP_055060.1
RefSeq Size 1616 bp
RefSeq ORF 342 bp
Locus ID 9616
UniProt ID Q9UBF6
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary The protein encoded by this gene is a highly conserved ring finger protein. It is an essential subunit of SKP1-cullin/CDC53-F box protein ubiquitin ligases, which are a part of the protein degradation machinery important for cell cycle progression and signal transduction. This protein interacts with, and is a substrate of, casein kinase II (CSNK2A1/CKII). The phosphorylation of this protein by CSNK2A1 has been shown to promote the degradation of IkappaBalpha (CHUK/IKK-alpha/IKBKA) and p27Kip1(CDKN1B). Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...