LAPTM4B (NM_018407) Human Untagged Clone

CAT#: SC113496

LAPTM4B (untagged)-Human lysosomal protein transmembrane 4 beta (LAPTM4B)



  "NM_018407" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-LAPTM4B Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LAPTM4beta; LC27
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC113496 sequence for NM_018407 edited (data generated by NextGen Sequencing)
ATGACGTCACGGACTCGGGTCACATGGCCAAGTCCGCCCCGCCCCCTCCCCGTCCCCGCC
GCTGCAGCGGTCGCCTTCGGAGCGAAGGGTACCGACCCGGCAGAAGCTCGGAGCTCTCGG
GGTATCGAGGAGGCAGGCCCGCGGGCGCACGGGCGAGCGGGCCGGGAGCCGGAGCGGCGG
AGGAGCCGGCAGCAGCGGCGCGGCGGGCTCCAGGCGAGGCGGTCGACGCTCCTGAAAACT
TGCGCGCGCGCTCGCGCCACTGCGCCCGGAGCGATGAAGATGGTCGCGCCCTGGACGCGG
TTCTACTCCAACAGCTGCTGCTTGTGCTGCCATGTCCGCACCGGCACCATCCTGCTCGGC
GTCTGGTATCTGATCATCAATGCTGTGGTACTGTTGATTTTATTGAGTGCCCTGGCTGAT
CCGGATCAGTATAACTTTTCAAGTTCTGAACTGGGAGGTGACTTTGAGTTCATGGATGAT
GCCAACATGTGCATTGCCATTGCGATTTCTCTTCTCATGATCCTGATATGTGCTATGGCT
ACTTACGGAGCGTACAAGCAACGCGCAGCCTGGATCATCCCATTCTTCTGTTACCAGATC
TTTGACTTTGCCCTGAACATGTTGGTTGCAATCACTGTGCTTATTTATCCAAACTCCATT
CAGGAATACATACGGCAACTGCCTCCTAATTTTCCCTACAGAGATGATGTCATGTCAGTG
AATCCTACCTGTTTGGTCCTTATTATTCTTCTGTTTATTAGCATTATCTTGACTTTTAAG
GGTTACTTGATTAGCTGTGTTTGGAACTGCTACCGATACATCAATGGTAGGAACTCCTCT
GATGTCCTGGTTTATGTTACCAGCAATGACACTACGGTGCTGCTACCCCCGTATGATGAT
GCCACTGTGAATGGTGCTGCCAAGGAGCCACCGCCACCTTACGTGTCTGCCTAA

Clone variation with respect to NM_018407.4
Restriction Sites NotI-NotI     
ACCN NM_018407
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018407.3, NP_060877.3
RefSeq Size 2245 bp
RefSeq ORF 954 bp
Locus ID 55353
UniProt ID Q86VI4
Domains Mtp
Protein Families Transmembrane
Protein Pathways Lysosome
Gene Summary Required for optimal lysosomal function (PubMed:21224396). Blocks EGF-stimulated EGFR intraluminal sorting and degradation. Conversely by binding with the phosphatidylinositol 4,5-bisphosphate, regulates its PIP5K1C interaction, inhibits HGS ubiquitination and relieves LAPTM4B inhibition of EGFR degradation (PubMed:25588945). Recruits SLC3A2 and SLC7A5 (the Leu transporter) to the lysosome, promoting entry of leucine and other essential amino acid (EAA) into the lysosome, stimulating activation of proton-transporting vacuolar (V)-ATPase protein pump (V-ATPase) and hence mTORC1 activation (PubMed:25998567). Plays a role as negative regulator of TGFB1 production in regulatory T cells (PubMed:26126825). Binds ceramide and facilitates its exit from late endosome in order to control cell death pathways (PubMed:26280656).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...