PDZD11 (NM_016484) Human Untagged Clone
CAT#: SC114246
PDZD11 (untagged)-Human PDZ domain containing 11 (PDZD11)
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AIPP1; PDZK11; PISP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_016484 edited
TCGCTGTGGACTGCCCACTGGGCCTTGCCCGAGATGGACAGCCGGATTCCTTATGATGAC TACCCGGTGGTTTTCTTGCCTGCCTATGAGAATCCTCCAGCATGGATTCCTCCTCATGAG AGGGTACACCACCCGGACTACAACAATGAGTTGACCCAGTTTCTGCCCCGAACCATCACA CTGAAGAAGCCTCCTGGAGCTCAGTTGGGATTTAACATCCGAGGAGGAAAGGCCTCCCAG CTAGGCATCTTCATCTCCAAGGTGATTCCTGACTCTGATGCACATAGAGCAGGACTGCAG GAAGGGGACCAAGTTCTAGCTGTGAATGATGTGGATTTCCAAGATATTGAGCACAGCAAG GCTGTTGAGATCCTGAAGACAGCTCGTGAAATCAGCATGCGTGTGCGCTTCTTTCCCTAC AATTATCATCGCCAAAAAGAGAGGACTGTGCACTAGAAAGTTGCAGCCCACAGCCCTTCA TGTGGACTCTGTCATGACATGCTAACTAGACTTCAGGGGAGCCACTTCTGTTTTCAGCCC CTCCCTGGAATAGTGAGTTGGGAGGATGGGGAGACAGCTAACCAACTGCATTACCCAAAC CATATTGCACTTTTAGTTCCCTAGTTTTCTAGGTGAGCTTCATTCCCTGAAAGGAGGATG ATGATATCTAGGCATAACCTAGCCTGTGAGGAACCTAGTTAGGAAAGACAACTGACATTT ATTGAATATCATGCACTAGTCCCTTACATATGTCATATTTTAATTATAGAAATCAGTAGC AAAAAGAATCTTGGGGATTTTCCATCTGACTTCCCTGGCCATCTTATCCCATCCTTGCAC TACCAGAAGATTCATACACTTTTGAGACTCCAGTGAGACGCTGTTTTCACCCCTTCCTCC TCCTAGCCTCTCTCCCAAAAAGTAAAACACAATGCTGAAGAAAAAAAAAAAAAAAAAAAA AAAAAAAAAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_016484 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_016484.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_016484.3, NP_057568.1 |
| RefSeq Size | 1731 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 51248 |
| UniProt ID | Q5EBL8 |
| Domains | PDZ |
| Protein Families | Secreted Protein |
| Gene Summary | Mediates docking of ADAM10 to zonula adherens by interacting with PLEKHA7 which is required for PLEKHA7 to interact with the ADAM10-binding protein TSPAN33.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Association of PDZ-containing protein PDZD11 with the human sodium-dependent multivitamin transporter
,Svetlana M. Nabokina, Veedamali S. Subramanian, and Hamid M. Said,
Am J Physiol Gastrointest Liver Physiol, Apr 2011; 300: G561 - G567
[PDZD11]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201049 | PDZD11 (Myc-DDK-tagged)-Human PDZ domain containing 11 (PDZD11) |
CNY 1200.00 |
|
| RC201049L3 | Lenti ORF clone of Human PDZ domain containing 11 (PDZD11), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201049L4 | Lenti ORF clone of Human PDZ domain containing 11 (PDZD11), mGFP tagged |
CNY 5890.00 |
|
| RG201049 | PDZD11 (tGFP-tagged) - Human PDZ domain containing 11 (PDZD11) |
CNY 2800.00 |
