SynCAM (CADM1) (NM_014333) Human Untagged Clone
CAT#: SC115048
CADM1 (untagged)-Human cell adhesion molecule 1 (CADM1), transcript variant 1
CNY 7030.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BL2; IGSF4; IGSF4A; Necl-2; NECL2; RA175; sgIGSF; ST17; sTSLC-1; SYNCAM; synCAM1; TSLC1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC115048 representing NM_014333.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGAGTGTAGTGCTGCCGAGCGGATCCCAGTGTGCGGCGGCAGCGGCGGCGGCGGCGCCTCCCGGG CTCCGGCTCCGGCTTCTGCTGTTGCTCTTCTCCGCCGCGGCACTGATCCCCACAGGTGATGGGCAGAAT CTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGT GACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTG AAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCA ATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATC ACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAG ATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAACACA GAGCTAAAAGGCAAATCGGAGGTGGAAGAGTGGTCAGACATGTACACTGTGACCAGTCAGCTGATGCTG AAGGTGCACAAGGAGGACGATGGGGTCCCAGTGATCTGCCAGGTGGAGCACCCTGCGGTCACTGGAAAC CTGCAGACCCAGCGGTATCTAGAAGTACAGTATAAGCCTCAAGTGCACATTCAGATGACTTATCCTCTA CAAGGCTTAACCCGGGAAGGGGACGCGCTTGAGTTAACATGTGAAGCCATCGGGAAGCCCCAGCCTGTG ATGGTAACTTGGGTGAGAGTCGATGATGAAATGCCTCAACACGCCGTACTGTCTGGGCCCAACCTGTTC ATCAATAACCTAAACAAAACAGATAATGGTACATACCGCTGTGAAGCTTCAAACATAGTGGGGAAAGCT CACTCGGATTATATGCTGTATGTATACGATCCCCCCACAACTATCCCTCCTCCCACAACAACCACCACC ACCACCACCACCACCACCACCACCATCCTTACCATCATCACAGATTCCCGAGCAGGTGAAGAAGGCTCG ATCAGGGCAGTGGATCATGCCGTGATCGGTGGCGTCGTGGCGGTGGTGGTGTTCGCCATGCTGTGCTTG CTCATCATTCTGGGGCGCTATTTTGCCAGACATAAAGGTACATACTTCACTCATGAAGCCAAAGGAGCC GATGACGCAGCAGACGCAGACACAGCTATAATCAATGCAGAAGGAGGACAGAACAACTCCGAAGAAAAG AAAGAGTACTTCATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_014333 |
| Insert Size | 1329 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_014333.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_014333.3 |
| RefSeq Size | 4324 bp |
| RefSeq ORF | 1329 bp |
| Locus ID | 23705 |
| UniProt ID | Q9BY67 |
| Domains | ig, IGc2, IG |
| Protein Families | Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs) |
| MW | 48.5 kDa |
| Gene Summary | Mediates homophilic cell-cell adhesion in a Ca(2+)-independent manner. Also mediates heterophilic cell-cell adhesion with CADM3 and NECTIN3 in a Ca(2+)-independent manner. Acts as a tumor suppressor in non-small-cell lung cancer (NSCLC) cells. Interaction with CRTAM promotes natural killer (NK) cell cytotoxicity and interferon-gamma (IFN-gamma) secretion by CD8+ cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM3 in vivo. May contribute to the less invasive phenotypes of lepidic growth tumor cells. In mast cells, may mediate attachment to and promote communication with nerves. CADM1, together with MITF, is essential for development and survival of mast cells in vivo. Acts as a synaptic cell adhesion molecule and plays a role in the formation of dendritic spines and in synapse assembly (By similarity). May be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. May play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) lacks two alternate in-frame exons compared to variant 3. The resulting isoform (1, also known as D) has the same N- and C-termini but is shorter compared to isoform A. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
MicroRNA-155-3p promotes breast cancer progression through down-regulating CADM1
,Zhang, G;Zhong, L;Luo, H;Wang, S;,
Onco Targets Ther
,PubMed ID 31579252
[CADM1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215477 | CADM1 (Myc-DDK-tagged)-Human cell adhesion molecule 1 (CADM1), transcript variant 1 |
CNY 5488.00 |
|
| RC215477L1 | Lenti ORF clone of Human cell adhesion molecule 1 (CADM1), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC215477L2 | Lenti ORF clone of Human cell adhesion molecule 1 (CADM1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC215477L3 | Lenti ORF clone of Human cell adhesion molecule 1 (CADM1), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC215477L4 | Lenti ORF clone of Human cell adhesion molecule 1 (CADM1), transcript variant 1, mGFP tagged |
CNY 7888.00 |
|
| RG215477 | CADM1 (tGFP-tagged) - Human cell adhesion molecule 1 (CADM1), transcript variant 1 |
CNY 7088.00 |
