SNX12 (NM_013346) Human Untagged Clone

CAT#: SC115295

SNX12 (untagged)-Human sorting nexin 12 (SNX12)



  "NM_013346" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
SNX12 mouse monoclonal antibody, clone OTI3A4 (formerly 3A4)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC115295 sequence for NM_013346 edited (data generated by NextGen Sequencing)
ATGTCGGACACGGCAGTAGCTGATACCCGGCGCCTTAACTCGAAGCCGCAGGACCTGACC
GACGCTTACGGGCCGCCAAGTAACTTCCTGGAGATCGACATCTTTAATCCTCAGACGGTG
GGCGTGGGACGCGCGCGCTTCACCACCTATGAGGTTCGCATGCGGACAAACCTACCTATC
TTCAAGCTAAAGGAGTCCTGCGTACGGCGGCGCTACAGTGACTTTGAGTGGCTGAAAAAT
GAGCTGGAGAGAGATAGCAAGATTGTAGTACCACCACTGCCTGGGAAAGCCTTGAAGCGG
CAGCTCCCTTTCCGAGGAGATGAAGGGATCTTTGAGGAGTCTTTCATCGAAGAAAGGAGG
CAGGGCCTCGAGCAGTTTATTAACAAAATTGCTGGGCACCCACTGGCTCAGAATGAACGC
TGCCTACACATGTTCCTGCAAGAGGAGGCAATTGACAGGAACTACGTCCCGGGGAAGGTG
CGCCAGTAG

Clone variation with respect to NM_013346.2
>OriGene 5' read for NM_013346 unedited
GCACGAGGCTCCTTCGGAAAGAGTCGGACACGGCAGTAGCTGATACCCGGCGCCTTAACT
CGAAGCCGCAGGACCTGACCGACGCTTACGGGCCGCCAAGTAACTTCCTGGAGATCGACA
TCTTTAATCCTCAGACGGTGGGCGTGGGACGCGCGCGCTTCACCACCTATGAGGTTCGCA
TGCGGACAAACCTACCTATCTTCAAGCTAAAGGAGTCCTGCGTACGGCGGCGCTACAGTG
ACTTTGAGTGGCTGAAAAATGAGCTGGAGAGAGATAGCAAGATTGTAGTACCACCACTGC
CTGGGAAAGCCTTGAAGCGGCAGCTCCCTTTCCGAGGAGATGAAGGGATCTTTGAGGAGT
CTTTCATCGAAGAAAGGAGGCAGGGCCTCGAGCAGTTTATTAACAAAATTGCTGGGCACC
CACTGGCTCAGAATGAACGCTGCCTACACATGTTCCTGCAAGAGGAGGCAATTGACAGGA
ACTACGTCCCGGNGAAGGTGCGCCAGTAGGAGCCCCTCTCACCACCTGCCCTCTA
Restriction Sites NotI-NotI     
ACCN NM_013346
Insert Size 2440 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013346.2, NP_037478.2
RefSeq Size 642 bp
RefSeq ORF 489 bp
Locus ID 29934
UniProt ID Q9UMY4
Domains PX
Gene Summary This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. A similar protein in mouse may be involved in regulating the neurite outgrowth. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and represents use of an alternate promoter, compared to variant 1. Both variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...