TIMM17B (NM_005834) Human Untagged Clone
CAT#: SC116485
TIMM17B (untagged)-Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DXS9822; JM3; TIM17B |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_005834.1
GCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATTGTGGATGATTGCGGTGGA
GCCTTCACTATGGGTGTCATCGGTGGCGGAGTCTTCCAGGCCATCAAGGGTTTCCGCAAT GCCCCTGTTGGAATTCGGCACCGGTTGAGAGGTAGTGCCAATGCTGTGAGGATCCGAGCC CCCCAGATTGGAGGTAGCTTCGCAGTGTGGGGGGGCCTGTTCTCCACCATTGACTGTGGC CTGGTGCGGCTTCGGGGCAAGGAGGATCCCTGGAACTCTATCACCAGTGGAGCATTGACC GGGGCTGTGCTGGCTGCCCGCAGTGGCCCACTGGCCATGGTGGGCTCAGCAATGATGGGG GGCATCCTGTTGGCCCTCATTGAGGGCGTTGGCATCCTCCTCACTCGCTACACAGCCCAG CAGTTCCGAAATGCGCCCCCATTCCTGGAGGACCCCAGCCAGCTGCCCCCTAAGGATGGC ACCCCGGCCCCAGGCTACCCCAGCTATCAGCAGTACCACTGAGGAAGCCACTGCCACCAT GGGAGCTACTTCTCGGTTCCCTCCCCGATGGTCTACCTCGAAGGGAGGGCTGGCTCCCAG TTAGCCCTGGGACCCTCCAGAGAGGGTTTCTACTCTGCTCCCTAGTCCCAGGGTGGGGGT GGGGCACCCCAGCTGCCCTGACAGATGGGTCCCCTTTTTCTCTCTCAGGGCACCCCAGCC CCACACTCACATGTACGAAGTTCTCACCCCAGCTCCTTTGTGTGGCACCCTGATGAGTAT TTAAAGCCCGTTTTGAAATGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_005834 |
| Insert Size | 950 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005834.1, NP_005825.1 |
| RefSeq Size | 960 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 10245 |
| UniProt ID | O60830 |
| Domains | Tim17 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a multipass transmembrane protein that forms an integral component of the mitochondrial translocase TIM23 complex. This complex facilitates the transport of mitochondrial proteins from the cytosol across the mitochondrial inner membrane and into the mitochondrion. There is a pseudogene for this gene on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2, also known as hTim17b) is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203992 | TIMM17B (Myc-DDK-tagged)-Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2400.00 |
|
| RC203992L3 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203992L4 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG203992 | TIMM17B (tGFP-tagged) - Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4000.00 |
|
| SC320370 | TIMM17B (untagged)-Human translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2400.00 |
其它TIMM17B产品
