Cystatin F (CST7) (NM_003650) Human Untagged Clone

CAT#: SC117836

CST7 (untagged)-Human cystatin F (leukocystatin) (CST7)



  "NM_003650" in other vectors (4)

CNY 2950.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CST7 Rabbit polyclonal Antibody
    • 100 ul

CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMAP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_003650, the custom clone sequence may differ by one or more nucleotides


ATGCGAGCGGCTGGAACTCTGCTGGCCTTCTGCTGCCTGGTCTTGAGCACCACTGGGGGCCCTTCCCCAG
ATACTTGTTCCCAGGACCTTAACTCACGTGTGAAGCCAGGATTTCCTAAAACAATAAAGACCAATGACCC
AGGAGTCCTCCAAGCAGCCAGATACAGTGTTGAAAAGTTCAACAACTGCACGAACGACATGTTCTTGTTC
AAGGAGTCCCGCATCACAAGGGCCCTAGTTCAGATAGTGAAAGGCCTGAAATATATGCTGGAGGTGGAAA
TTGGCAGAACTACCTGCAAGAAAAACCAGCACCTGCGTCTGGATGACTGTGACTTCCAAACCAACCACAC
CTTGAAGCAGACTCTGAGCTGCTACTCTGAAGTCTGGGTCGTGCCCTGGCTCCAGCACTTCGAGGTGCCT
GTTCTCCGTTGTCACTGA


Restriction Sites NotI-NotI     
ACCN NM_003650
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003650.3, NP_003641.3
RefSeq Size 940 bp
RefSeq ORF 438 bp
Locus ID 8530
UniProt ID O76096
Domains CY
Protein Families Secreted Protein
Gene Summary The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...