Phospholamban (PLN) (NM_002667) Human Untagged Clone

CAT#: SC118501

PLN (untagged)-Human phospholamban (PLN)



  "NM_002667" in other vectors (6)

CNY 1200.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
Goat Anti-Phospholamban / PLN Antibody
    • 100 ug

CNY 5371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMD1P; CMH18; PLB
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002667 edited
ATGGAGAAAGTCCAATACCTCACTCGCTCAGCTATAAGAAGAGCCTCAACCATTGAAATG
CCTCAACAAGCACGTCAAAAGCTACAGAATCTATTTATCAATTTCTGTCTCATCTTAATA
TGTCTCTTGCTGATCTGTATCATCGTGATGCTTCTCTGA
>OriGene 5' read for NM_002667 unedited
NTAACGTTCAGATTTGTAAACGACTCATATAGGCGGCCGCGNAATTCGNCCAGNANAAAA
CTCCCCAGCTAAACACCCGTAAGACTTCATACAACACAATACTCTATACTGTGATGATCA
CAGCTGCCAAGGCTACCTAAAAGAAGACAGTTATCTCATATTTGGCTGCCAGCTTTTTAT
CTTTCTCTCGACCACTTAAAACTTCAGACTTCCTGTCCTGCTGGTATCATGGAGAAAGTC
CAATACCTCACTCGCTCAGCTATAAGAAGAGCCTCAACCATTGAAATGCCTCAACAAGCA
CGTCAAAAGCTACAGAATCTATTTATCAATTTCTGTCTCATCTTAATATGTCTCTTGCTG
ATCTGTATCATCGTGATGCTTCTCTGAAGTTCTGCTACAACCTCTAGATCTGCAGCTTGC
CACATCAGCTTAAAATCTGTCATCCCATGCAGACAGGAAAACAATATTGTATAACAGACC
ACTTCCTGAGTAGAAGAGTTTCTTTGTGAAAAGGTCAAGATTAAGACTAAAACTTATTGT
TACCATATGTATTCATCTGTTGGATCTTGTAAACATGAAAAGGGCTTTATTTTCAAAAAT
TAACTTCAAAATAAGTGTATAAAATGCAACTGTTGATTTCCTCAACATGGCTCACAAATT
TCTATCCCAAATCTTTTCTGAAGATGAAGAGTTTAGTTTTAAAACTGCACTGCCAACAAG
TTCACTTCATATATAAAGCATTATTTTTACTCTTTTTGAGTGAATATAATTTATATTACC
ATGTANAAGCCTCTTTAATACTAAGTATTTTTCAGGTCTTCACCAAGTATCANNAGTATT
ACACANATGAAGTGTCATTATTCAAATAGTCCACTGACTCTCACATCTTGTATCTTAT
Restriction Sites NotI-NotI     
ACCN NM_002667
Insert Size 2600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002667.2, NP_002658.1
RefSeq Size 1712 bp
RefSeq ORF 159 bp
Locus ID 5350
UniProt ID P26678
Protein Families Transmembrane
Protein Pathways Calcium signaling pathway, Dilated cardiomyopathy
Gene Summary The protein encoded by this gene is found as a pentamer and is a major substrate for the cAMP-dependent protein kinase in cardiac muscle. The encoded protein is an inhibitor of cardiac muscle sarcoplasmic reticulum Ca(2+)-ATPase in the unphosphorylated state, but inhibition is relieved upon phosphorylation of the protein. The subsequent activation of the Ca(2+) pump leads to enhanced muscle relaxation rates, thereby contributing to the inotropic response elicited in heart by beta-agonists. The encoded protein is a key regulator of cardiac diastolic function. Mutations in this gene are a cause of inherited human dilated cardiomyopathy with refractory congestive heart failure, and also familial hypertrophic cardiomyopathy. [provided by RefSeq, Apr 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...