GABPB2 (GABPB1) (NM_002041) Human Untagged Clone

CAT#: SC118866

GABPB1 (untagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-1



  "NM_002041" in other vectors (5)

CNY 3656.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
GABPB1 mouse monoclonal antibody,clone OTI7A7
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_002041, the custom clone sequence may differ by one or more nucleotides


ATGTCCCTGGTAGATTTGGGAAAGAAGCTTTTAGAAGCGGCACGAGCAGGTCAAGATGATGAAGTTCGTA
TTTTGATGGCAAATGGAGCTCCCTTTACTACAGACTGGCTGGGAACTTCTCCACTTCATCTAGCAGCACA
GTATGGTCATTATTCCACCACAGAGGTACTGCTGCGAGCTGGTGTGAGCAGAGATGCCAGAACCAAAGTG
GACCGAACACCATTACATATGGCAGCTTCTGAGGGCCATGCCAGCATAGTAGAGGTTTTACTTAAGCATG
GTGCTGATGTCAATGCAAAGGACATGTTAAAGATGACAGCTCTCCATTGGGCCACAGAACACAATCATCA
AGAGGTGGTGGAACTTTTAATCAAATATGGTGCTGATGTACACACGCAAAGTAAATTTTGTAAAACTGCA
TTTGATATTTCAATAGACAATGGAAATGAAGATTTAGCAGAGATATTACAGATTGCTATGCAGAACCAAA
TCAACACAAACCCAGAGAGTCCTGACACTGTGACAATACATGCTGCAACACCACAGTTTATCATTGGACC
TGGAGGGGTGGTGAACCTAACAGGTCTGGTATCTTCAGAAAATTCATCCAAGGCAACAGATGAAACGGGT
GTATCTGCTGTTCAGTTTGGAAACTCTTCTACATCAGTATTAGCTACATTAGCTGCCTTAGCTGAAGCAT
CTGCTCCATTGTCCAATTCTTCAGAAACTCCAGTAGTGGCCACAGAAGAAGTAGTTACTGCAGAATCTGT
GGATGGTGCCATTCAGCAAGTAGTTAGTTCAGGGGGTCAGCAAGTCATCACAATAGTTACAGATGGAATT
CAGCTTGGAAATTTGCACTCTATTCCAACCAGTGGAATTGGTCAGCCCATCATTGTGACCATGCCAGATG
GACAACAAGTATTAACAGTACCAGCAACAGACATTGCTGAAGAAACTGTTATAAGTGAAGAACCACCAGC
TAAGAGACAATGTATCGAAATAATTGAAAACCGGGTGGAATCTGCAGAAATAGAAGTAAGGAGTCTTTTA
CCCGGTGTGCTTTGCCGCAGTCATCCAAAATAA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites NotI-NotI     
ACCN NM_002041
Insert Size 2740 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002041.1, NP_002032.1
RefSeq Size 1658 bp
RefSeq ORF 1152 bp
Locus ID 2553
UniProt ID Q06547
Protein Families Transcription Factors
Gene Summary This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (gamma 1) uses an alternate in-frame splice site in the 3' coding region, compared to variant beta 1, resulting in a shorter isoform (gamma 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...