PLA2G5 (NM_000929) Human Untagged Clone
CAT#: SC119544
PLA2G5 (untagged)-Human phospholipase A2, group V (PLA2G5)
CNY 7112.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FRFB; GV-PLA2; hVPLA(2); PLA2-10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_000929, the custom clone sequence may differ by one or more nucleotides
ATGAAAGGCCTCCTCCCACTGGCTTGGTTCCTGGCTTGTAGTGTGCCTGCTGTGCAAGGAGGCTTGCTGG ACCTAAAATCAATGATCGAGAAGGTGACAGGGAAGAACGCCCTGACAAACTACGGCTTCTACGGCTGTTA CTGCGGCTGGGGCGGCCGAGGAACCCCCAAGGATGGCACCGATTGGTGCTGTTGGGCGCATGACCACTGC TATGGGCGGCTGGAGGAGAAGGGCTGCAACATTCGCACACAGTCCTACAAATACAGATTCGCGTGGGGCG TGGTCACCTGCGAGCCCGGGCCCTTCTGCCATGTGAACCTCTGTGCCTGTGACCGGAAGCTCGTCTACTG CCTCAAGAGAAACCTACGGAGCTACAACCCACAGTACCAATACTTTCCCAACATCCTCTGCTCCTAG |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_000929 |
Insert Size | 2500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000929.1, NP_000920.1 |
RefSeq Size | 1911 bp |
RefSeq ORF | 1911 bp |
Locus ID | 5322 |
UniProt ID | P39877 |
Domains | PA2c |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
Gene Summary | This gene is a member of the secretory phospholipase A2 family. It is located in a tightly-linked cluster of secretory phospholipase A2 genes on chromosome 1. The encoded enzyme catalyzes the hydrolysis of membrane phospholipids to generate lysophospholipids and free fatty acids including arachidonic acid. It preferentially hydrolyzes linoleoyl-containing phosphatidylcholine substrates. Secretion of this enzyme is thought to induce inflammatory responses in neighboring cells. Alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207789 | PLA2G5 (Myc-DDK-tagged)-Human phospholipase A2, group V (PLA2G5) |
CNY 1800.00 |
|
RC207789L1 | Lenti-ORF clone of PLA2G5 (Myc-DDK-tagged)-Human phospholipase A2, group V (PLA2G5) |
CNY 4200.00 |
|
RC207789L2 | Lenti-ORF clone of PLA2G5 (mGFP-tagged)-Human phospholipase A2, group V (PLA2G5) |
CNY 4200.00 |
|
RC207789L3 | Lenti-ORF clone of PLA2G5 (Myc-DDK-tagged)-Human phospholipase A2, group V (PLA2G5) |
CNY 4200.00 |
|
RC207789L4 | Lenti-ORF clone of PLA2G5 (mGFP-tagged)-Human phospholipase A2, group V (PLA2G5) |
CNY 4200.00 |
|
RG207789 | PLA2G5 (tGFP-tagged) - Human phospholipase A2, group V (PLA2G5) |
CNY 5420.00 |