ALR (GFER) (NM_005262) Human Untagged Clone

CAT#: SC122704

GFER (untagged)-Human growth factor, augmenter of liver regeneration (GFER)



  "NM_005262" in other vectors (7)

CNY 3990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-GFER Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALR; ERV1; HERV1; HPO; HPO1; HPO2; HSS; MMCHD; MPMCD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_005262, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGCCCGGCGAGCGGGGCCGCTTCCACGGCGGGAACCTCTTCTTCCTGCCGGGGGGCGCGCGCT
CCGAGATGATGGACGACCTGGCGACCGACGCGCGGGGCCGGGGCGCGGGGCGGAGAGACGCGGCCGCCTC
GGCCTCGACGCCAGCCCAGGCGCCGACCTCCGATTCTCCTGTCGCCGAGGACGCCTCCCGGAGGCGGCCG
TGCCGGGCCTGCGTCGACTTCAAGACGTGGATGCGGACGCAGCAGAAGCGGGACACCAAGTTTAGGGAGG
ACTGCCCGCCGGATCGCGAGGAACTGGGCCGCCACAGCTGGGCTGTCCTCCACACCCTGGCCGCCTACTA
CCCCGACCTGCCCACCCCAGAACAGCAGCAAGACATGGCCCAGTTCATACATTTATTTTCTAAGTTTTAC
CCCTGTGAGGAGTGTGCTGAAGACCTAAGAAAAAGGCTGTGCAGGAACCACCCAGACACCCGCACCCGGG
CATGCTTCACACAGTGGCTGTGCCACCTGCACAATGAAGTGAACCGCAAGCTGGGCAAGCCTGACTTCGA
CTGCTCAAAAGTGGATGAGCGCTGGCGCGACGGCTGGAAGGATGGCTCCTGTGACTAG


Restriction Sites Please inquire     
ACCN NM_005262
Insert Size 2400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005262.1, NP_005253.2
RefSeq Size 2447 bp
RefSeq ORF 378 bp
Locus ID 2671
UniProt ID P55789
Gene Summary The hepatotrophic factor designated augmenter of liver regeneration (ALR) is thought to be one of the factors responsible for the extraordinary regenerative capacity of mammalian liver. It has also been called hepatic regenerative stimulation substance (HSS). The gene resides on chromosome 16 in the interval containing the locus for polycystic kidney disease (PKD1). The putative gene product is 42% similar to the scERV1 protein of yeast. The yeast scERV1 gene had been found to be essential for oxidative phosphorylation, the maintenance of mitochondrial genomes, and the cell division cycle. The human gene is both the structural and functional homolog of the yeast scERV1 gene. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...